BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

 

Number of entries returned: 7982

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameIUPAC CS referencingProteinDNARNAOther
246growth factorXX
357adrenocorticotropinXX
614neurotoxin IIIXX
888lysozymeXX
1175phosphoglycerate kinaseXX
1176phosphoglycerate kinaseXX
1177phosphoglycerate kinaseXX
1475cyclophilinXX
1486copper-zinc superoxide dismutaseXX
1487copper-zinc superoxide dismutaseXX
1844phosphoglycerate kinaseXX
1845phosphoglycerate kinaseXX
1846phosphoglycerate kinaseXX
2068barnaseXX
2069barnaseXX
2265subtilisin inhibitorXX
3065cro repressorXX
3127CaBPXX
3128CaBPXX
3433Src tyrosine kinaseXX
4052staphylococcal nucleaseXX
4053staphylococcal nucleaseXX
4065designed four-alpha-helix bundle proteinXX
4068turkey ovomucoid third domainXX
4072RNA-1 Modulator ProteinXX
4089peptide deformylaseXX
4097RNase H domain of HIV-1 RVT strain BH10XX
410314mer DNA duplex containing the operator sequence BS2XX
4104BS2 operator DNA complexed with the Antennapedia HomeodomainXXX
4109rat CD2 domain 1XX
4126single chain three helix bundleXX
4133Tropomyosin GCN4 chimeraXX
4140EH1 domain of mouse Eps15XX
4141vnd/NK-2 homeodomain DNA complexXXX
4145Tec Src Homology 3 (SH3) domainXX
4150third extracellular N-terminal domain of gp130XX
4151F1FO ATP Synthase Subunit cXX
4153Retinoid-X-Receptor -alpha DNA Binding domainXX
4154oxidized putidaredoxinXX
4155EotaxinXX
4156Protein Disulfide IsomeraseXX
4157lactoferricinXX
4159Long Neurotoxin 1 (Component LSIII)XX
4160Tn916 integrase subunit 1XX
4161IRF-2 DNA binding domainXX
4163Aesculus hippocastanum Antimicrobial Protein 1XX
4164pyoverdin G4RXX
4165Tn916 integrase DNA complexXXX
4166C2A domain of synaptotagmin IXX
4167C2A domain of synaptotagmin IXX
4169pyoverdin G4RXX
4170DNA-duplex-6GPXX
4177Monocyte chemoattractant protein-3XX
4183DtxR subunit 3, C-terminal domainXX
4185gurmarinXX
4188C2 Domain of Cytosolic Phospholipase A2XX
4189cytochrome cXX
4194D-Pro melittinXX
4195Alpha-Bungaratoxin/Library Peptide ComplexXX
4200c-Myc-Max Heterodimeric Leucine ZipperXX
4203Cn2(1-15)NH2-S-S-AcetylCn2(52-66)NH2XX
4206fibronectinXX
4212synthetic L-peptide corresponding the the G-H loop of the foot-and-mouth disease virus VP1 proteinXX
4219eel calcitoninXX
4223TATA box binding protein associated factor II 230XX
4225Glutaredoxin 3 systemXX
4229Fe8S8 FdXX
4232Calcium binding subunit of troponin, TnC monomerXX
4237MinE topological specificity domainXX
4242Major Sperm ProteinXX
4245ubiquitinXX
4248Lymphoid enhancer-binding factorXXX
4251Src homology domain 3 and 2XX
4252Abl SH(32) complexXX
4253T2 RNA PseudoknotXX
4254Mbp1XX
4256Mbp1(2-124)XXX
4260GlcNAc eel calcitoninXX
4261M6 eel calcitoninXX
4264Phosphotransferase system, enzyme IXX
42687-Fe FerredoxinXX
4269gamma delta resolvase catalytic coreXX
4276PlasminogenXX
4278Long-[L60]-IGF-IXX
4279Centruroides sculpturatus Ewing Toxin IXX
4282XRCC1 N-terminal domainXX
4284Calmodulin-Ca2+-Pump-Peptide ComplexXX
4285S100A dimerXX
4286Snc1XX
4287Sso1XX
4291Cytochrome C3XX
4295Titin type I domainXX
4296Major cold shock protein from E. coliXX
4298V3 loop peptide of RF HIV-1 gp120 envelope proteinXX
4301Pathogenesis-related Protein P14aXX
4302protein disulfide isomerase a' domainXX
4304neuronal nitric oxide synthase PDZ domain complexed with a peptideXX
4305protein inhibitor of neuronal nitric oxide synthaseXX
4307Recombinant Syrian hamster prion proteinXX
4308cytokine receptor common beta chain domain 4XX
4310calmodulin:SL3 Enhancer Factor2-1 complexXX
4311human T-cell leukemia virus type I capsid monomerXX
4312bromodomainXX
4313ARDXX
4314HCC-2 chemokineXX
4315Iron-containing superoxide dismutaseXX
4316subunit c of ATP synthaseXX
4317NS1(1-73) dimerXX
4318glutaredoxin 2XX
4319Oxidized RubredoxinXX
4320Reduced RubredoxinXX
4321p55 monomer in complex with CoAXX
4322consensus V3 loop peptideXX
4326N-Terminal Domain of DNA Polymerase BXX
4327N-terminal inhibitory domain of human tissue inhibitor of metalloproteinases-1XX
4328N-terminal domain of HsRad51XX
4329E.coli Transhydrogenase domain IIIXX
4330ALPHA-BETA T CELL RECEPTOR (TCR) (D10)XX
4331Streptomyces subtilisin inhibitorXX
4333FADD death domainXX
4340major urinary proteinXX
4341Iron-containing superoxide dismutaseXX
4344CopZXX
4349Fv fragment of the catalytic antibody NPN43C9XX
4353p13 c-terminal domainXX
4355tetramerization domain of the Mnt repressorXX
4365stromelysin-ligand complexesXX
4366stromelysin-ligand complexesXX
4368A35T vnd/NK2 mutant homeodomainXXX
4371Recombinant Onconase/P30 proteinXX
4379human prion protein fragment 121-230XX
4381Third EH domain of human Eps15XX
4382RubredoxinXX
4383wheat ns-LTPXX
4385elongation factor-1betaXX
4387thanatinXX
4388Cyclic AMP Receptor Protein dimerXX
4389Ribosome Recycling FactorXX
4390CC-chemokine eotaxinXX
4392DNA minor groove binderXX
4395RIBOSOMAL PROTEIN L25XX
4396Nematode Anticoagulant Protein c2XX
4397fractalkineXX
4399ImIXX
4400H-y5 Triple HelixXX
4401skeletal N-troponin CXX
4402human prion protein hPrP(23-230)XX
4403Polyomavirus J domainXX
4406contryphan-RXX
4408contryphan-R (minor form)XX
4411transforming growth factor beta3XX
4413p73XX
4417Major Pollen Allergen Bet v 1-LXX
4418cytotoxin 2, minor formXX
4419cytotoxin 2, major formXX
4421PhoB DNA-binding domainXX
4425ACETYL-COA CARBOXYLASEXX
4426ACETYL-COA CARBOXYLASEXX
4427toxin 7XX
4429ribosomal protein L7 from E. coliXX
4432glycine receptor alpha 1 subunit TM2 segmentXX
4433glycine receptor alpha 1 subunit TM2 segment S267YXX
4434Human prion protein fragment 90-230XX
4436CYTOCHROME C3XX
4437MEROZOITE SURFACE PROTEIN 1XX
4438Sterol carrier protein 2SeeXX
4439Human Ferredoxin oxidizedXX
4440Human Ferredoxin reducedXX
4441Anabaena 7120 vegetative FerredoxinXX
4442Anabaena 7120 vegetative FerredoxinXX
4444FerredoxinXX
4445HRDC domainXX
4448Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolaseXX
4449antifreeze protein type III intramolecular dimer RD3XX
4451N-terminal domain of caspase-activated DNaseXX
4452sea raven Type II antifreeze proteinXX
4453alpha-actinin/titin complexXX
4454alpha-actinin/titin complexXX
4455CD58 adhesion domain, 1dCD58XX
4456aIIb cytoplasmic domainXX
4457E-cadherinXX
4461Cycloviolacin O1XX
4463Ras-binding domain of Byr2XX
4464contryphan-SmXX
4465His117Gly azurinXX
4467chicken MeCP2/ARBP monomerXX
4468contryphan-SmXX
4469Des[Gly1]-contryphan-RXX
4470ThiSXX
4471cytochrome c552XX
4472BeFx-activated CheY from E. coliXX
4473Camp dependent protein kinase type ii regulatory chainXX
4478PKD1 HUMANXX
4493Ubiquitin core mutant 1D7XX
4506type IIA bacteriocin carnobacteriocin B2XX
4522MAP30XX
4524Endoglucanase SS dockerin domainXX
455150S RIBOSOMAL PROTEIN L9XX
4554Dihydrofolate reductase complex with NADPH cofactorXX
4557herpes simplex virus protein ICP47XX
4558YopH-NT monomerXX
4560T4MODXX
4561ImperatoxinXX
4563Bovine prion protein fragment 121-230XX
4564Bovine prion protein fragment 23-230XX
4566bovine adrenodoxinXX
4567catalytic domain of yUBC1XX
4571RPB10XX
4572PBX homeodomainXX
4575N-terminal 24 kDa fragment of gyrase BXX
4576a3T3 hybridXX
4581CALBINDIN D9KXX
4588ChBD-ChiA1XX
4604THE PEPTAIBOL CHRYSOSPERMIN C BOUND TO DPC MICELLESXX
4630THROMBOMODULINXX
4631SKELETAL DIHYDROPYRIDINE RECEPTORXX
4632Pro-Apoptotic Protein BAXXX
4634Multifunctional aminoacyl-tRNA synthetase(E.C.6.1.1.17)XX
4635MAD1 PROTEIN/SIN3AXX
4639human Rap1XX
4650SHEEP PRION PEPTIDEXX
4661Apoptotic protease activating factor 1XX
4663protein (1D8 UBIQUITIN) mutant (I3L,I13L,L15V,V17L,I23V,V26L,I61L,L67I)XX
4664lipocalin Q83XX
4666transcarboxylase 1.3S subunitXX
4668FK506 binding protein from Methanococcus thermolithotrophicusXX
4669HEPATITIS C CAPSID PROTEINXX
4673ileal lipid binding proteinXX
4680C-terminal domain of MLTDXX
4697fMet-tRNA binding domain of initiation factor IF2XX
4702C-terminal negative regulatory domain of p53 in complex with Ca2+ -bound S100B(bb)XX
4717C-terminal FtsZ binding domain of E. coli ZipAXX
4718replication terminator proteinXX
4719Ras binding domain of rat AF6XX
4720Inhibitor-2 monomerXX
4721general transcription factor TFIIE-BETAXX
4728EGF 3 module from human vitamin K-dependent protein SXX
4729EGF-like module pair 3-4 from human vitamin K-dependent protein SXX
4735olfactory marker proteinXX
4738Cu(II) Plastocyanin from Anabaena variabilisXX
4739Calcium Vector ProteinXX
4740MTH1184 monomerXX
4744cytochrome c7XX
4751mouse lysozymeXX
4762NITROGEN REGULATION PROTEINXX
4763NITROGEN REGULATION PROTEINXX
4770Cell Division Control Protein 42 from Candida albicansXX
4775SPINDLE ASSEMBLY CHECKPOINT PROTEIN MAD2XX
4777cytochrome c552XX
4781SL2 stem loop RNA from HIV-1XXX
4788Reps1 EH domainXX
4799HIV-1 Vpr (13-33)XX
4800isolated reduced c domain of the cytochrome cd1 nitrite reductaseXX
4801isolated oxidized c domain of the cytochrome cd1 nitrite reductaseXX
4802N-terminal domain of H-NSXX
4815CYTOTOXIN 2XX
4818N-Terminal Domain of MKP-3XX
4820Pheromone Er-22XX
4821DcuSXX
4822N terminal domain of Cardiac Troponin CXX
4823N terminal domain of Cardiac Troponin CXX
4824N terminal domain of Cardiac Troponin CXX
4825Recombinant RC-RNase 2XX
4829Interleukin enhancer binding factorXX
4831hen egg white lysozymeXX
4850GLUTAREDOXIN 3XX
4854N-terminal domain of 5-enolpyruvyl shikimate-3-phosphate synthaseXX
4858NUCLEOLIN RBD1XX
4863NUCLEOLIN RBD2XX
4864Turkey Ovomucoid Third DomainXX
4865Turkey Ovomucoid Third Domain bound to bovine chymotrypsin AaXX
4867NUCLEOLIN RBD12/RNA COMPLEXXXX
4869NON HISTONE PROTEIN 6 AXX
4870region 4 of sigma70 of E. coli RNA polymerase holoenzymeXX
4871Bin1XX
4874mSin3B-PAH2 free stateXX
4878Calreticulin P-domainXX
4881Azotobacter vinelandii C69A holoflavodoxin IIXX
48841st LIM domain of PINCH proteinXX
4886Azotobacter vinelandii C69A apoflavodoxin IIXX
4888c-Src SH3 monomerXX
4889c-Src SH3 RLP2 peptide complexXX
4890CDK-ACTIVATING KINASE ASSEMBLY FACTOR MAT1XX
4891chinese cobrotoxinXX
4893Recombinant RC-RNase 4XX
4896response-regulator protein CheY2XX
4897Pilus Associated with Pyelonephritis subunit GXX
4900C-terminal xylan binding moduleXX
4905G88W110 fragment of staphylococcal nucleaseXX
4910LEKTI domain oneXX
4911DYNEIN light chain 8 (dlc8) and nNOS (fragment peptide) complexXX
4912DYNEINXX
4913cAMP-regulated phosphoprotein-19 monomerXX
4916PITUITARY ADENYLATE CYCLASE ACTIVATING POLYPEPTIDE WITH N-TERMINAL 21 RESIDUES WITH AN AMIDATED C-TERMINUSXX
4919ERp29 N-domainXX
4920ERp29 C-domainXX
4921PONERATOXINXX
4922unfolded apoplastocyaninXX
4924Tityustoxin K-alphaXX
4925N-Ada10XX
4926chymotrypsin inhibitor 2XX
4928WSTF-PHDXX
4929Tctex1 dimerXX
4931DYNEINXX
4934p53 dimerXX
4936Outer membrane protein X in DHPC micellesXX
4938mouse doppelXX
4941Ku70 DNA binding domain at the C-terminusXX
4943Chicken Egg White LysozymeXX
4945Vam3p N-terminal domainXX
4950HIV-1 NefXX
4951HIV-1 NefXX
4953trigger factor PPIase domainXX
4954Riboflavin Synthase N-domainXX
4955Cysteinyl-phosphorylated enzyme IIBXX
4958His6PSCD4XX
4961YopH complexXX
4964barnaseXX
4966Cardiotoxin A3XX
4967Mason-Pfizer Monkey Virus proteaseXX
4969Bruc D4.4 VH fragmentXX
4970CalmodulinXX
4971Truncated amino-terminal Carp Granulin-1XX
4972CrhXX
4973SaratinXX
4974Chymotrypsin Inhibitor 2XX
4977lipid transfer proteinXX
4978B0 isoform of the 3rd(C-terminal) globular domain of agrinXX
4981fifth domain of beta2-glycoprotein IXX
4983YUH1XX
4984CheWXX
4985flavodoxin-like domain of the Escherichia coli sulfite reductaseXX
4989B. subtilis ACYL CARRIER PROTEINXX
4990Betacellulin-2XX
4991thioredoxin like proteinXX
4992toluene 4-monooxygenaseXX
4995GlyTM1bZip coiled-coil dimerXX
4996MTH865XX
4997[Thr(B27)->Pro,Pro(B28)->Thr]-insulinXX
4999nucleocapsid binding domain of the sendai virus phosphoproteinXX
5000C-Terminal Domain of PAC-1XX
5004human interleukin-13XX
5007VS RIBOZYME SUBSTRATE STEM-LOOPXX
5008p13suc1XX
5009p13suc1XX
5010DNA Polymerase XXX
5012the third domain of MMP-2XX
5013E6AP catalytic domainXX
5014MyBP-C cC5XX
5019mNPAS2(78-240)XX
5027human fibronectin EDAXX
5028TRYPSIN INHIBITOR IIXX
5031KaiA N-terminusXX
5038HsUbc2bXX
5040I1(I29T) monomerXX
5041DNA Ligase III, BRCT domain (E.C.6.5.1.1)XX
5042Human lymphotactin monomerXX
5044NEURAL CELL ADHESION MOLECULEXX
5047LCCL module of human coch-5b2 proteinXX
5048cellular retinol-binding protein type IXX
5050Bungarus fasciatus IXXX
5051MTH1692XX
5052neurotoxin IIXX
5053C-terminal domain of Pab1pXX
5054Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase complexed with ATPXX
5056Arabidopsis thaliana trypsin/chymotrypsin inhibitorXX
5057Alzheimer peptide Ab(1-40) of manXX
5058GABARAPXX
5059EC005XX
5060TM006 protein from Thermotoga maritimaXX
5061DNA-binding domain of ADR6XX
5064GABAA receptor associated proteinXX
5065CYSTEINE-RICH PROTEIN 2XX
5067lipoyl domain of dihydrolipoyl dehydrogenase P64KXX
5070C-terminal domain of tyrosyl-tRNA synthetaseXX
5071troponin C, skeletal muscleXX
5072CD3 Epsilon and gamma Ectodomain Fragment ComplexXX
5075Apolipoprotein(a) kringle IV type 6XX
5077M156RXX
5078Lipoyl acid-bearing domain of human BCKD complexXX
5079cytochrome c552XX
5080cytochrome c552XX
5081Gallium protoporphyrin IX-HasAsm complexXX
5082Tc1 monomerXX
5083Epidermal-type fatty acid binding proteinXX
5084PABC-Paip1 complexXX
5085PABC-Paip2 complexXX
5086Hydrogenobacter thermophilus cytochrome c-552XX
5087Hydrogenobacter thermophilus cytochrome c-552XX
5088Hydrogenobacter thermophilus cytochrome c-552XX
5089Hydrogenobacter thermophilus cytochrome c-552XX
5092beta2 subunit of BK channelsXX
5093RbfADelta25XX
5096U-SHAPED TRANSCRIPTIONAL COFACTORXX
5097bucandinXX
5099N-terminus of Tissue Inhibitor of Metalloproteinases-1/Matrix MetalloProteinase-3(E202Q)(deltaC) complexXX
5100Intramolecular complex of LMO2(LIM1) and ldb1(LID)XX
5101ubiquitin fragmentXX
5102SK2 calmodulin binding domainXX
5103s100p dimerXX
5104MTH0637XX
5105EC298XX
5106MTH1743XX
5107Sensor and Substrate Binding Domain from Lon (La) Protease (E. coli)XX
5114KALATA B1XX
5115gamma subunit of dissimilatory siroheme-sulfite reductaseXX
5116gamma subunit of dissimilatory siroheme-sulfite reductaseXX
5117RhodostominXX
5119subunit c of ATP synthaseXX
5120mEGF/TGFalpha44-50 chimeraXX
5121N-terminal domain of DnaB helicaseXX
5122cyclic N-terminal domain of DnaB helicaseXX
5127murine mts1XX
5128GABARAP monomerXX
5129MTH1880 without calciumXX
5130human lysozyme at 35 degree CXX
5131Second PDZ domain of PTP-BLXX
5132attm+4XX
5141SasA N-terminusXX
5142human lysozymeXX
5143alpha2A adrenergic receptorXX
5144rhodopsinXX
5145human DoppelXX
5147metallothioneinXX
5148METHANE MONOOXYGENASE COMPONENT CXX
5149D130I mutant T3-I2(D130I) peptideXX
5150T3-I2-T4 peptideXX
5153N-terminal domain of Tissue Inhibitor of Metalloproteinases-1/MatrixMetalloProteinase-3(E202Q)(deltaC) complexXX
5154N-terminal domain of Tissue Inhibitor of Metalloproteinases-1XX
5156calretininXX
5159Ran-binding domain 2 of RanBP2XX
5161Nucleotide binding domain of the Sarco(Endo)plasmic Reticulum Ca2+-ATPaseXX
5162SRm160XX
5165Conserved Hypothetical Protein MTH1598XX
5166hemolysin expression modulating protein HhaXX
5172Oxidized cytochrome c553 from Bacillus pasteuriiXX
5173Epiregulin monomerXX
5177chick cofilinXX
5178chitinase fibronectin type III domainXX
5179vav n-terminal SH3 domainXX
5182GluR2 Extracellular Ligand-Binding DomainXX
5183BetaCoreXX
5184toxin BeKm from the scorpion Buthus eupeusXX
5185vascular endothelial growth factor receptor-binding domain dimer in complex with peptide v107XX
5186vascular endothelial growth factor receptor-binding domain dimerXX
5187TraR monomerXX
5188paralytic peptide of Bombyx moriXX
5189S100A11 homodimerXX
5190ribosome recycling factorXX
5191ribosome recycling factorXX
5196Skeletal Dihydropydrine ReceptorXX
5197mouse prion proteinXX
5198peptide v107 in complex with vascular endothelial growth factor receptor-binding domain dimerXX
5199necrosis inducing proteinXX
5202CNP catalytic domainXX
5203cysteine-rich domain of KSRXX
5204Calreticulin P-domain fragment 189-261XX
5205Calreticulin P-domain fragment 221-256XX
5206S100B dimerXX
5208Palm-Thumb Domain of DNA Polymerase BXX
5209Palm-Thumb Domain of DNA Polymerase B in complex with XRCC1-NTDXX
5214Y2 selective analogue I of neuropeptide YXX
5215Y2 selective analogue II of neuropeptide YXX
5216Y2 selective analogue III of neuropeptide YXX
5219Escherichia coli formamidopyrimidine-DNA glycosylaseXX
5220Melanoma Inhibitory Activity ProteinXX
5221C-Terminal Region of Ku86XX
5223SH3 domain of the tyrosine-protein kinase LckXX
5225Parvulin 10XX
5226Ssh10b dimerXX
5227smMLCK:CaM complexXX
5228ACTR in complex with the CREB binding protein, CBPXX
5233ASC2XX
5234TyrR transcription factor central domain of E.coliXX
5235Human Lupus autoantigen proteinXX
5236RCK4XX
5238heparin-binding domain of vascular endothelial growth factor-165XX
5239dvh c3oxXX
5242prohormone convertase 1 pro-domainXX
5244endonuclease VXX
5246Human insulin mutantXX
5247murine mts1XX
5248Pin1 N-terminal WW domainXX
5249desulforedoxinXX
5250GlcT-RBD dimerXX
5251lymphotactinXX
5255WmKTXX
5257Thymosin beta-9XX
5260desulforedoxinXX
5261Nuclease A InhibitorXX
5262first fibronectin type II module of human matrix metalloproteinase 2XX
5263CBM28 of CelIXX
5264Human Beta-defensin 3XX
5265moricin monomerXX
5267SdbA type II cohesin moduleXX
5268tachystatin AXX
5270YqgFXX
5271desulforedoxinXX
5272Schistocerca gregaria chymotrypsin inhibitorXX
5273Schistocerca gregaria chymotrypsin inhibitor variant L30R,K31MXX
5274Schistocerca gregaria trypsin inhibitorXX
5275sialic acid binding domain of rhesus rotavirus VP4XX
5278Pea Enation Mosaic Virus P1-P2 frameshifting pseudoknotXX
5283HIV-1 Vpr (34-51)XX
5286CaM:CaMKIp complexXX
5287CaM:CaMKI(320) complexXX
5288Grb7 SH2 domain / phosphorylated peptide complexXX
5289third helix of Antennapedia homeodomainXX
5290third helix[W6F,W14F] of Antennapedia homeodomainXX
529112 amino acid long derivative of the third helix of Antennapedia homeodomainXX
5292Trp-cage Construct 5bXX
5293Barstar pH 2.7 160 kD aggregateXX
5294beta subunit of translation initiation factor 2XX
5295brazzeinXX
5296brazzein RIXX
5298PPIase monomerXX
5299MITOTIC SPINDLE ASSEMBLY CHECKPOINT PROTEIN MAD2A/PEPTIDEXX
5300ORF C32E8.3XX
5302Islet amyloid polypeptideXX
5305Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1XX
5306hypoxia inducible factor-1alpha/p300 complexXX
5307Basic Pancreatic Trypsin InhibitorXX
5308Human-E.coli chimeric thioredoxinXX
5309Fusion of the LIM binding domain of Ldb1 and the N-terminal LIM domain of LMO4XX
5312aIF2betaXX
5313Gap Junction 43kDa Carboxyl TerminusXX
5314Grb14 SH2 domain/phosphorylated undecapeptide complexXX
5315Protein YfiaXX
5319cellular retinol-binding protein type IXX
5320B-FABPXX
5322gamma-bungarotoxin monomerXX
5325Plant nsLTP2XX
5327Hif-1alpha/CBP complexXX
5328DNA Ligase BRCT domainXX
5329C. elegans protein ZK652.3XX
5330cellular retinol-binding protein type IXX
5331cellular retinol-binding protein type IXX
5332recoverin mutant, E85QXX
5333cytochrome c3XX
5334NTD HTLV-I capsid proteinXX
5335YacGXX
5337human adrenodoxinXX
5338IEGF-3XX
53395'-D(*CP*GP*TP*AP*CP*G)-3'XX
5340proapoptotic bidXX
5343Neocarzinostatin apo-proteinXX
5344Neocarzinostatin apo-protein - small molecule complexXX
5345LACTOSE OPERON REPRESSOR/DNA ComplexXXX
5346platelet aggregation inhibitor disintegrinXX
5347RNase H domain of the HIV-1 reverse transcriptaseXX
5348ati monomerXX
5349Extended PBX Homeodomain-DNA complexXXX
5350human cytoplasmic tyrosine phosphatase AXX
5352xylanase of Bacillus agaradhaerensXX
5353yeast Saccharomyces cerevisiae calmodulinXX
5354Human PAS Kinase PAS-A domainXX
5355Hsp90 N-terminal ATPase domainXX
5356GS-a3W proteinXX
5357tm1112XX
5363hERR2-DNA complexXXX
5364TapXX
5366Vacuolar morphogenesis proteinXX
5368human ADP Ribosylation Factor 1XX
5372CYTOCHROME CXX
5374protein of 2S albumin storage protein from Ricinus communisXX
5376complex of transducin peptide and rhodopsinXX
5377Ca(2+)S100B-TRTK-12 peptide complexXX
5378Human prion protein fragment 121-230 with mutations Met166Cys and Glu221CysXX
5379PANCREATIC POLYPEPTIDEXX
5382the C-terminal domain of EPSP synthaseXX
5383IP-10XX
5384Glycine extended gastrin peptideXX
5386cNTnC-cTnI(147-162)-Bepridil Ternary ComplexXX
5387ubiquitinXX
5388Gads C-terminal SH3 domainXX
5389YfiaXX
5390DNA-binding Protein H-NSXX
5394U2 snRNA - Intron duplexXX
5395Unmodified U2 snRNA - Intron duplexXX
5396ternary complex DHFR-trimethoprim-NADPHXX
53983-methyladenine DNA glycosylase IXX
5399Erg Pointed DomainXX
5400beta-amyloid 1-42XX
5401GABPalpha Pointed DomainXX
5402sh2 domainXX
5403trp RNA-binding attenuation protein undecamerXX
5404E. coli Peptide DeformylaseXX
5405peptide n3XX
5408DFF40/DFF45 heterodimerXX
5409PTB1-12XX
5410obtustatinXX
5411OMTKY3XX
5412P2'-Lys OMTKY3XX
5413P2'-His OMTKY3XX
5414P2'-Glu OMTKY3XX
5415P2'-Asp OMTKY3XX
5416P3'-Ala OMTKY3XX
5417P3'-Asp OMTKY3XX
5418P3'-Glu OMTKY3XX
5419P3'-His OMTKY3XX
5420P3'-Lys OMTKY3XX
5421P1'-Asp OMTKY3XX
5422P1'-His OMTKY3XX
5423P1'-Lys OMTKY3XX
5424P1-Asp OMTKY3XX
5425P1-Glu OMTKY3XX
5426P1-Gly OMTKY3XX
5427P1-Ala OMTKY3XX
5428P1-His OMTKY3XX
5429P1-Lys OMTKY3XX
5430P2-Asp OMTKY3XX
5431P2-Glu OMTKY3XX
5432P2-Val OMTKY3XX
5433P2-His OMTKY3XX
5434P2-Lys OMTKY3XX
5435P4-Asp OMTKY3XX
5436P4-Glu OMTKY3XX
5437P4-His OMTKY3XX
5438P4-Lys OMTKY3XX
5439P4-Asp OMTKY3XX
5440P5-Asp OMTKY3XX
5441P5-Glu OMTKY3XX
5442P5-His OMTKY3XX
5443P6-Asp OMTKY3XX
5444P6-Glu OMTKY3XX
5445P6-His OMTKY3XX
5446P2-Val,P3'-Ala OMTKY3XX
5447P8-Phe,P6-Asp OMTKY3XX
5448OMTKY3XX
5449P5-His OMTKY3XX
5450P4-Glu OMTKY3XX
5451AAPDXX
5452AAPEXX
5453AAPKXX
5454motilinXX
5455PRL-3XX
5456von Willebrand factor-A3 domainXX
5457complex of hMad1-Sin Interacting Domain (SID) and PAH2 domain of mSin3BXX
5458Ribosome Recycling FactorXX
5459EL5 RING-H2 finger domainXX
5461Interleukin-2 tyrosine kinase src homology 2 domainXX
5467ADAPXX
54686-phosphogluconolactonaseXX
5469omsvp3 monomerXX
5470p14c/n39c monomerXX
5472Ovomucoid Third DomainXX
5473Ovomucoid Third DomainXX
5475plastocyanin synechocistys PCC 6803XX
5476F1XX
5477tF1XX
5478F1tbpXX
5479sF1XX
5480Calmodulin-olfactory channel peptide complexXX
5481Hub1XX
5482DC 45-150XX
5483N-acetylmuramyl-L-alanine amidaseXX
5484BpUreE dimerXX
5486Tachyplesin IXX
5487Tachyplesin I, tyrosine mutantXX
5488Tachyplesin I, phenylalanine mutantXX
5489Tachyplesin I, alanine mutantXX
5490Pru av 1 E45WXX
5491scarabaecin monomerXX
5493Acyl carrier protein synthaseXX
5494PW2 Bound to SDS MicellesXX
5495psalmotoxin1XX
5496ubiquitin-like domain in murine PARKINXX
5497DsbD C-terminal domainXX
5499AMPA receptor interacting proteinXX
5504Csk homologous kinase SH2 domainXX
5505Cu (II) Plastocyanin from Anabaena VariabilisXX
5506double moduleXX
5507Transthyretin TetramerXX
5508TransthyretinXX
5509TransthyretinXX
5510TransthyretinXX
5511p21 Rac1 GTPaseXX
5515Dishevelled-2 DIX dimerXX
5517B-MybR2R3XXX
5518Turkey Ovomucoid Third DomainXX
5519Indian Peafowl Ovomucoid Third DomainXX
5520Turkey Ovomucoid Third DomainXX
5521Indian Peafowl Ovomucoid Third DomainXX
55224th fas-1 domain of beta ig-h3XX
5523Melanin-Concentrating HormoneXX
5532Tumor Susceptibility gene 101 protein/Gag PolyproteinXX
5534Apolipoprotein CII in complex with SDS-micellesXX
5535R3H domainXX
5536G88W110 fragment of Staphylococcal NucleaseXX
5538PWWP domainXX
5539Xis C28SXX
5540flavodoxin monomerXX
5541Lm-FABPXX
5544Ca2+-loaded S100B(beta beta)-TRTK-12 peptide complexXX
5547streptococcal pyrogenic exotoxin BXX
5548PANCREATIC POLYPEPTIDEXX
5551LEKTI domain 6 (HF7665) monomerXX
5554N-WASP EVH1 Domain-WIP complexXX
5558Sp100b SAND domainXX
5560TM1290 conserved hypothetical proteinXX
5562CCGCGGXX
5563ParG dimerXX
5564kinase associated protein phosphatase kinase interaction domainXX
5565porcine MSPXX
5568YML108WXX
5570DR0079XX
5571flavodoxin monomerXX
5572spruce budworm antifreeze proteinXX
5573spruce budworm antifreeze proteinXX
5580Type B lantibiotic mersacidinXX
5581Type B lantibiotic mersacidinXX
5582Type B lantibiotic mersacidinXX
5583MHC CLASS II-ASSOCIATED P41 INVARIANT CHAIN FRAGMENT (P41icf)XX
5585alpha-conotoxin GIDXX
55865'-R(*GP*GP*CP*(P5P)P*AP*GP*CP*CP*U)-3'XX
55875'-R(*GP*GP*CP*AP*(P5P)P*GP*CP*CP*U)-3'XX
55885'-R(*GP*GP*CP*(P5P)P*(P5P)P*GP*CP*CP*U)-3'XX
5589VC0424XX
5590DNA-binding domain in RTBP1XX
5591cC2 domainXX
5594U-box from Prp19XX
5595NosLXX
5596ygguXX
5597cytochrome cXX
5598receptor associated protein-domain 1XX
5599Human ProlactinXX
5600rubredoxinXX
5601rubredoxinXX
5602DR2356XX
5603proguanylinXX
5604ZNTA (E.C.3.6.3.3/E.C.3.6.3.5)XX
5605SAM22XX
5607Human Neuronal Glycine Receptor alpha-1 Chain TM2XX
5609kalata B1XX
5610C terminus of rat striated muscle alpha tropomyosin encoded by exon 9aXX
5612floral defensin-like protein 1XX
5613bhpW, disulfide cyclized beta-hairpin peptideXX
56145'-R(*GP*GP*CP*AP*AP*GP*CP*CP*U)-3'XX
5615C-RcsBXX
5618DiisopropylfluorophosphataseXX
5619methionine sulfoxide reductase BXX
5620ribosomal protein S28EXX
5621yoag ecoliXX
5623matrix protein from Moloney Murine Leukemia Virus matrix proteinXX
5624translation initiation factor IF2XX
5626Droshophila GCMXX
5627A. aeolicus UDP-3-O-acyl-GlcNAc deacetylase in complex with TU-514XX
5628C-terminal domain [276-437] of the human EF1Bgamma subunit from elongation factor 1XX
5629MTH187XX
5630ER75 monomerXX
5633MOLT-INHIBITING HORMONEXX
5634SS1XX
5635SS2XX
5636SS3XX
5637SS4XX
5638SS5XX
5639SS6XX
5640SS7XX
5641SS8XX
5642SS9XX
5643SS10XX
5644SS11XX
5645SS12XX
5646SS13XX
5647SS14XX
5648SS15XX
5649SS16XX
5650L23XX
5651Txk SH3 domainXX
5652CnErg1XX
5653MIHXX
5656staphylococcal protein A Z domainXX
5657Methanobacterium thermoautotrophicumXX
5658ISG15XX
5660oxidized cytochrome cXX
5661PKC iota (V1 domain)XX
5662CPI-17(22-120)XX
5663CPI-17(22-120) mutant T38DXX
5664oxytetracycline acyl carrier proteinXX
5665Clpx Zinc Finger dimerXX
5666truncated GFPuvXX
5667First zinc finger of Zinc finger protein 265XX
56683-methyladenine DNA glycosylase IXX
5669Npl4 Zinc Finger domainXX
5670Hellethionin DXX
5676Pandinus imperator potassium channel blocking toxin 4XX
5677focal adhesion targeting domain of focal adhesion kinaseXX
5678HNF6 proteinXX
5679xylan-binding domainXX
5680CFP-10 in complex with unlabelled ESAT-6XX
568230S ribosomal protein S27eXX
5683QR6XX
5685RAP74/FCP1XX
5687protein S-824XX
5688cathelin-like domain of the protegrin-3 precursorXX
5689Pheromone Binding Protein from Antheraea polyphemusXX
5690cobra neurotoxin IIXX
569130S ribosomal protein S28EXX
56924th LIM domain of PINCH proteinXX
5693Ligand loaded growth factor receptor-bound protein 2XX
5694chignolinXX
5695YHR087W gene productXX
5696ZASP-PDZ DomainXX
5697ZASP-PDZ domain in complex with Alpha-Actinin-2 EF-hand domainsXX
5698C-terminal domain of poly(A)-binding proteinXX
5700p63 DNA-binding domainXX
5701SopE2 momomerXX
5702Omega-atracotoxin-Hv1aXX
5706TipASXX
5707Bet v 4XX
5708PTS system, glucose-specific IIA component (E.C.2.7.1.69)XX
5709TPR domain of hSGTXX
5710Mth11 free in solutionXX
5711Biotinoyl domain of HP0371XX
5712eIF4EXX
5713human prion proteinXX
5714Synthetic DNA duplex with an AG mismatchXX
5715HHP-tagged E. coli ThioredoxinXX
5716CK14 DNA 14-MER DUPLEXXX
5717XBY6 DNA 14-MER DUPLEXXX
5718XBY2 DNA 14-MER DUPLEXXX
5719La proteinXX
5722complex between Ca2+/C-terminal domain of caltractin and 19-resiude peptide from Kar1pXX
5723wt brazzeinXX
5724Arg43Ala-brazzeinXX
5725Ala2insertion-brazzeinXX
5726Asp50Ala-brazzeinXX
5727His31Ala-brazzeinXX
5728Arg33Ala-brazzeinXX
5729C-terminal SH3 domain of SEM-5 from C. elegansXX
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplexXX
5731SCR3 peptide (18-34)XX
5732SCR3 peptide (18-54)XX
5733SCR3 peptide (34-54)XX
5734SCR3 peptide (27-33)XX
5735rat amyloid beta-peptide 1-28XX
5736IClnXX
5740Dihydrofolate reductaseXX
5741Dihydrofolate reductaseXX
5742COX assembly proteinXX
5743extracellular domain of beta subunit of dystroglycanXX
5744human alpha-synucleinXX
5745bovine microsomal cytochrome b5XX
5747Homodimeric Alpha2 Four-Helix BundleXX
5748p270 or Human SWI1XX
5749Sl-moricin monomerXX
5750BLyS Receptor 3XX
5752human Integrin alpha2 I-domainXX
5754VASP EVH1 domainXX
5755Phosphatase Regenerating Liver 2XX
5756fluorescein-binding lipocalinXX
5758YqgFXX
5759cytochrome P450camXX
5760Z1Z2XX
5761gamma-adaptin ear domainXX
5762PDZ2-ASXX
5763SAV1595XX
5764ALYXX
5771tff3 dimerXX
5772SlxA CBM13XX
5773HIV-1 STEM LOOP SL1 MONOMERIC RNAXX
5774Cleavage stimulation Factor 64, RRM domainXX
5776sPrODN1:RNAXXX
5777PODN:RNAXXX
5778Pleckstrin Homology domain of the human Protein Kinase B betaXX
5781Propynyl DNA.RNA hybridXXX
5785Matrix MetalloProteinase-3 in complex with N-TIMP-1XX
5786Neural cadherinXX
5787RC-RNase 3XX
5788CBP/p300-interacting transactivators with a glutamic acid/aspartic acid (ED)-rich tail/p300 complexXX
5789nitrogen regulatory enzyme IIAXX
5790Hypothetical protein AQ 1857XX
5792CyaYXX
5793RecR dimerXX
5794Lck SH3-SH2 domain pairXX
5797Hypothetical protein ta1414XX
5798Protein yrbAXX
5799PSP monomerXX
5800Escherichia coli N utilization substance (339-495)XX
5801T1EXX
5802Outer mitochondrial membrane cytochrome b5XX
5803hen egg white lysozymeXX
5804hen egg white lysozymeXX
5805Rpp29XX
5806penaeidin-3XX
5807gpDXX
5809human hemglobin AXX
5810cysteine proteinase inhibitorXX
5811GGRRDGGYGG monomerXX
5812GGYGGGRRDG monomerXX
5814C terminal domain of human VIAFXX
5816YLR109w dimerXX
5817Neurogenic locus notch homolog protein 1XX
5818YbcJXX
5819CuA domainXX
5824KaiA C-terminal domainXX
5825KaiA C-terminal domainXX
5826BpUreEXX
5827Horse cytochrome cXX
5828Horse cytochrome cXX
5829Horse cytochrome c (wt) reduced formXX
5830Horse cytochrome c (wt) oxidized formXX
5833mob1XX
5834HIV-1 frameshift inducing stem-loop RNAXX
5835Recombinant onconaseXX
5837Sodium ChannelXX
5839GB3XX
5841kinase associated protein phosphatase, kinase interaction domainXX
5842IR24XX
5843expressed protein: At3g17210.1XX
5845MW2441 proteinXX
5846MR19 monomerXX
5847SdaXX
5848S-locus pollen proteinXX
5850protein tyrosine phosphatase (E.C.3.1.3.48)XX
5852A mimic of the VS Ribozyme Hairpin SubstrateXX
5857GSH-SIP7-50XX
5860Subtilosin AXX
5861gtpase domain MnmEXX
5862TRADD death domainXX
5863FkpAXX
5864Neurokinin BXX
5868UV excision repair protein RAD23 homolog BXX
5869Alpha-A-conotoxin EIVAXX
5871Ara h 6XX
5873BlaI N-terminal domainXX
5874p47 monomerXX
5876p47 monomerXX
5878region 1463-1617 of mouse 53BP1XX
5879S.typhi type IVb pilinXX
5881SmIIIAXX
5883eumenine mastoparanXX
5885DIMER OF FUSED DOCKING DOMAINS OF DEBS2 AND DEBS3XX
5886TF1 ATPase Beta SubunitXX
5887nuclear transport factor 2XX
5888nuclear transport factor 2 W7A mutantXX
5889nucleoporin Nsp1 528-557XX
5890Hylaseptin P1XX
5891Sso10aXX
5892Sso10b2XX
5893VU-1 calmodulinXX
5894drosophila SLBP N-terminusXX
5896VU-1 calmodulin/F-stop complexXX
5897homolog Bcl-2 Epstein Barr VirusXX
5899Sporulation initiation phosphotransferase FXX
5902Hath domain of hepatoma-derived growth factor (hHDGF)XX
5904inhibitor-1aXX
5905Sac7dXX
5906dopamine and cAMP-regulated phosphoprotein, Mr. 32,000XX
5907Ku80 CTDXX
5908Sac7d V30I monomerXX
5909Sso7d monomerXX
5910Sso7d monomerXX
5912ATP-dependent DNA helicase II, 80 kDa subunitXX
5913Neurotoxin Cn11XX
5914Met-enkephalinXX
5916empaf, eumenine mastoparanXX
5917translationXX
5918Thermus thermophilus Ribonuclease HIXX
5919Loop E of 5S rRNA from spinach chloroplastsXX
5920PrrA C-terminal domainXX
5921TM1442XX
5922Potassium voltage-gated channel subfamily H member 2XX
5923T22G mutant of the N-terminal SH3 domain of the Drosophila protein drkXX
5924FAT domain of Focal adhesion kinase (920-1053)XX
5925SH2-SH3 adapter protein drkXX
5926RubredoxinXX
5929hypothetical rhodanase domainXX
5930aADTXX
5931RNase H domain of the HIV-1 reverse transcriptaseXX
5934f-MLF peptideXX
5935fructose-2,6-bisphosphataseXX
5936bADTXX
5937PDZ2b domain of PTP-Bas (hPTP1E)XX
5939Spred2 EVH1 domainXX
5940third domain of the interleukin-6 receptorXX
5944CD4 cytoplasmic tail - Lck N terminusXX
5945CD8a cytoplasmic tail - Lck N terminusXX
5946afaD-dscXX
5947donor strand complemented AfaE-IIIXX
5948Disintegrin kistrin, AKGDWN MutantXX
5949Disintegrin kistrin, ARGDWN MutantXX
5950Cell division Activator CedAXX
5953Human TGFB type II Receptor and Monomeric TGFB3 ComplexXX
5954Human TGFB type II ReceptorXX
5955VASP EVH2 domainXX
5958MAP-LC3 monomerXX
5959Antigen Ki-67 FHA domainXX
5966headpiece subdomainXX
5969holo-neocarzinostatinXX
597050S Ribosomal Protein L18XX
5971Domain III of the E protein of Langat flavivirusXX
5972ProP antiparallel coiled-coilXX
5973Dengue type 2 virus capsid proteinXX
5974BopEXX
5975N-terminal domain of trout cardiac troponin CXX
5976hypothetical protein TM0487XX
5977TM1492XX
5978HCV NS5A N-terminalXX
5981ternary complex of human DHFR with trimethoprim and NADPHXX
5982apolipoproteinXX
59835,10-methenyltetrahydrofolate synthetaseXX
5984FtsN RNP domainXX
5985alpha-Conotoxin GICXX
5986paralytic peptide of Antheraea yamamaiXX
5987CBP TAZ1 domain and CITED2 CADXX
5988alpha-bungarotoxin/ nicotinic acetylcholine receptor mimotope complexXX
5989Cytotoxin IXX
5991Murine Ets-1 deltaN301XX
5993DNA duplexXX
5994Orexin-AXX
5995Major Urinary Protein-IXX
5996Major Urinary Protein-IXX
5997STAT4 N-terminal domain, dimerXX
5998ApaG/CorD proteinXX
6000Drosophila Argonaute1 PAZ domainXX
6002p63 monomerXX
6004Cofilin, non-muscle isoformXX
6005TIS11d TZF/ 5'-UUAUUUAUU-3' complexXXX
6007tn3 calcium free formXX
6008tn3 with calcium boundXX
6010tm0979XX
6011At5g22580XX
6012Sgt1 CS domainXX
6013alpha-actinin-4 spectrin repeat 3XX
6015cC1 domainXX
6016beta-site APP Cleaving Enzyme 1XX
6017S100C/A11 fragmentXX
6018phosphorylated S100C/A11 fragmentXX
6019P62A dimerXX
6020Polyphemusin IXX
6021subunit a of the ATP synthaseXX
6022Copper-transporting ATPase 1XX
6023calmodulin-protein phosphatase 2B peptide complexXX
6024Beta-lactamase TEMXX
6025leukocyte cell-derived chemotaxin 2XX
6026Oxidized Human FerredoxinXX
6027Mu-conotoxin PIIIAXX
6028ribosomal protein S17EXX
6029Type IA potassium translocating ATPase B chainXX
6030Type IA potassium translocating ATPase B chainXX
6033C10A/C13A cytochrome c552 from Hydrogenobacter thermphilusXX
6034ear-domain of alpha-adaptin CXX
6035DNA ligase III alpha 1-117XX
6038Small inducible cytokine B11XX
604230mer stemloop-D of coxsackieviral RNAXX
6044La proteinXX
6045pfr13 monomerXX
6046West Nile Virus I, strain 385-99, Domain IIIXX
6047Organomercurial LyaseXX
6048Hb3361a peptideXX
6049Parvalbumin alphaXX
6050Endoribonuclease SSO7D single point mutant K12LXX
6051methionine sulfoxide reductase BXX
6052HR969XX
6053the N-terminal 16kDa domain of Ada ProteinXX
6054the methylated N-terminal 16kDa domain of Ada ProteinXX
6055merB / Hg / DTT complexXX
6056Yeast oligosaccharyltransferase subunit Ost4pXX
6057tandem SH3 domain in autoinhibited form of p47phoxXX
6058Hypothetical Archaeglobus fulgidis protein AF2095XX
6059Nore1XX
6060PDZ2 from PTP-BLXX
6061T1-61-DNase fusion proteinXX
6066K27A Hainantoxin-IVXX
6067K27A Hainantoxin-IVXX
6069Precarnobacteriocin B2XX
6070Endothelin-1XX
6072Protein inhibitor of activated STAT protein 1XX
6073Hypothetical superoxide dismutase-like protein yojMXX
6074PaDDAHXX
6076stem-loop RNAXX
6077stem-loop RNAXX
6078IA3XX
6079thioredoxin h1 from poplarXX
6081troponin CXX
6082methionine-rich 2S albumin from Sunflower seedXX
6084dh434(0-63)XX
6085hepcidinXX
6086recombinant MAGI-1 tandem WW domain regionXX
6087HCV p7XX
6090methionine sulfoxide reductase AXX
6091PDZ2 from PTP-BLXX
6092PDZ2 from PTP-BLXX
6094Psi site of MLVXX
6095CBP KIX domain and c-MybXX
6096Dynein light chain 1, cytoplasmicXX
6097U1C zinc finger domainXX
6102Hypothetical UPF0250 protein ybeDXX
6108Glycogen synthesis protein glgSXX
6110mutant of LEKTI domain 1XX
6111Choristoneura fumiferana antifreeze protein isoform 501XX
6114BRCTc domainXX
6115Rhonivirus CREXX
6116N-terminal domain of human eRF1XX
6117ChaBXX
6118glutaredoxinXX
6120Hypothetical protein CC1736XX
6122S1 monomerXX
6123Truncated hevein of 32 aaXX
6125enolase-phosphatase E1XX
6127p1 encoded proteinXX
6128At3g01050.1XX
6131Cytochrome b5XX
6132poplar phloem peroxiredoxinXX
6133YojN-HPtXX
6134d27ggXX
6135Mu-O-conotoxin MrVIBXX
6136E. coli L-Arabinose Binding ProteinXX
6137proBnIb monomerXX
6138At2g24940XX
6139Oela europea pollen allergen ole e 6XX
6140At3g16450.1XX
6143apolipoprotein C-IIXX
6144nisinXX
61453LII in DMSOXX
6146nisin/3LII complexXX
6147LuxUXX
6150fatty acid binding proteinXX
6152TUMOR INHIBITORY PROTEINXX
6154tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)XX
6155tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)XX
6156tandem repeat 1 of fibroin-modulator-binding-protein-1(residues 99-121)XX
6157tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)XX
6158saposin CXX
6167NucleobindinXX
6173PfR48XX
6174ThKaiA180C-CIIABD complexXX
6176Ubiquitin-like domain of tubulin-folding cofactor BXX
6179LEKTI Domain 15 shortXX
6180LEKTI Domain 15XX
6182FluA(R95K)XX
6183cAMP-dependent protein kinaseXX
6184N-terminal domain of the epsilon subunit of E. coli DNA polymerase IIIXX
61865'-D(P*TP*GP*AP*TP*CP*A)-3'XX
6187hypothetical protein PF1061XX
6191SecAXX
6192Omega-atracotoxin-Hv1aXX
6193PSD-95 PDZ3XX
6194Omega-atracotoxin-Hv1aXX
6197Src homology-3 domainXX
6198TM1816 monomerXX
61995,10 methenyltetrahydrofolate synthetaseXX
6202yUbc1XX
6203insulin analogueXX
6204insulin analogueXX
6205insulin analogueXX
6209N-domain of At3g03410.1XX
6211Carnobacteriocin B2 immunity proteinXX
6216Zinc finger protein ZFPM1XX
6217Cytotoxic linear peptide IsCTXX
6218Cytotoxic linear peptide IsCTXX
6221RpfBcXX
6222KurtoxinXX
6223YCD dimerXX
6224SufAXX
6225Tfb1XX
6226EW29 monomerXX
6228yeast TOR1 FATCXX
6229Thermus Thermophilus Dnak Nucleotide binding domainXX
6230human hemglobin AXX
6231hPAPXX
6232TM1442-PO4XX
6235SNARE complexXX
6236APP770XX
6237alpha-conotoxin OmIAXX
6239VSVI RNAXX
6240At5g66040XX
6241josephin domain of ataxin-3XX
6243azurinXX
6244Mycoplasma Genitalium gi3844938XX
6248MDM2XX
6250G88W121XX
6253gammaS-crystallinXX
6255Ribosomal Protein L16XX
6256TM1509 monomerXX
6257Abeta(1-40)XX
6258g3pN1 bound TolAIIIXX
6260IAAL-E3/K3 heterodimerXX
6261SH3 domain of Lyn Tyrosine KinaseXX
6262CG4244-PBXX
6268CBP TAZ1XX
6269chPrP (128-242)XX
6270chPrP (25-242)XX
6272MTH0776XX
6275Metal-response element-binding transcription factor-1XX
6276Metal-response element-binding transcription factor-1 complex with MRE DNAXXX
6278yeast Sed5pXX
6279murine angiogenin 4XX
6280double-stranded RNA-binding domains of adenosine deaminase acting on RNAXX
6281Complexin/SNARE complexXX
6282turtle PrP monomerXX
6285talin 755-889XX
6287GABPalpha pointed domainXX
6288Neurotoxin IXX
6289SecA CtXX
6290Nc metallothioneinXX
6291hypothetical membrane protein ta0354 69 121XX
6292Alkaline protease inhibitorXX
6293tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)XX
6294tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)XX
6295flavin domain of methane monooxygenase reductaseXX
6296tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)XX
6304SUMO-1XX
6308ERp57, domain aXX
6309OHFD3XX
6311Spry domain-containing SOCS box protein 2XX
6313Pheromone-binding proteinXX
6314RbfAXX
6317CylR2 dimerXX
6318Thioredoxin h1XX
6320U6 extended ISLXX
6321delta25-PYPXX
6324hypothetical protein TM0979XX
6325CREB Binding Protein (E.C.2.3.1.48)XX
6326CREB Binding ProteinXX
6327CREB Binding Protein (E.C.2.3.1.48)XX
6328CREB Binding Protein (E.C.2.3.1.48)XX
6329CREB Binding Protein (E.C.2.3.1.48)XX
6331SH2 domainXX
6332myosin light chainXX
6334Mip (77-213) monomerXX
6335redox-switch domain of Hsp33XX
6336AP4A hydrolase with ATPXX
6337AAH26994XX
6338At1g77540XX
6342survivin dimerXX
6344HR1958XX
6345ykr049cXX
6346h. plexin-B1 RBD-W1830FXX
6351KaliotoxinXX
6353RFC p140 375-480 BRCT region : DNA complexXXX
6354N-terminal domain of NECAP1 proteinXX
6356Yeast Frataxin homolog 1 proteinXX
6357Beta-lactamase TEMXX
6358Xcc975 monomerXX
6359YGGXXX
636040-61 bovine alpha-hemoglobin fragmentXX
6362NifU-like proteinXX
6364PF0470 monomerXX
6365Protein BC4709XX
6366Hypothetical protein yqbGXX
6367Hypothetical protein yhgGXX
6368Hypothetical protein rps24eXX
6369Protein BH1534XX
6371Sin3a associated polypeptide p18XX
6373catalytic domain of LexA L89P/Q92W/D150H/E152A/K156A mutant dimerXX
6374AIRE1-PHD1XX
6375TonB C-terminal Domain monomerXX
6376TgMIC1-CTXX
6377fPrP monomerXX
6378canine prion proteinXX
6380pig prion protein monomerXX
6381ovPrP,H168 monomerXX
6382prion proteinXX
6383eprp monomerXX
6384Tumor necrosis factor receptor superfamily member 13BXX
6385human pleckstrin Dep domainXX
6386aei monomerXX
6387aei-analogue monomerXX
6388Penaeidin-4dXX
6390R-moduleXX
6392human TSG-6XX
6393human TSG-6XXX
6395DivIB monomerXX
6396BC029172XX
6399TPR domain in p67phoxXX
6400wt maXX
6402CsrA dimerXX
6403Ovine Prion Protein Variant R168XX
6404Pcf11 CIDXX
6405CNR-EC1XX
6406TCR Va2.6Ja38XX
6407HPV16 E6 C-terminal domainXX
6408Metal-responsive element-binding transcription factor-1XX
6409Metal-responsive element-binding transcription factor-1XX
6410grx1XX
6411amidated fragment 48-61 of bovine alpha-hemoglobinXX
6412fragment 48-61of bovine alpha-hemoglobinXX
6413fragment 40-61XX
6414amidated fragment 33-52 of bovine alpha-hemoglobinXX
6415hen egg white lysozymeXX
6416apo-NikAXX
6418aequorin/Mg2+-bound stateXX
6419Variant surface glycoprotein MITAT 1.2XX
6427Antifreeze peptide SS-3XX
6431II-III loop region of the skeletal dyhydropyridine receptorXX
6433Entamoeba histolytica calcium binding protein 2XX
6434gpUXX
6437lf11 peptideXX
6438CikA C-terminusXX
6442PfTrxXX
6444MMP12XX
6445Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)XXX
6446Sodium/hydrogen exchanger 1XX
6447Major vault proteinXX
6448Hypothetical UPF0131 protein ytfPXX
6451CesT dimerXX
6452CLP-36 PDZXX
6453yggxXX
6456SH3 domain of Lyn Tyrosine Kinase with a herpesviral ligandXX
6459Itch WW3 domainXX
6462LactotransferrinXX
6463LfcinB4-14DisuXX
6468mitogen-activated protein kinase p38 alphaXX
6470UbiquitinXX
6474KI-FHA domain of KAPPXX
6478Transition state regulatory protein abrBXX
6479Excisionase from transposon Tn916XX
6485GluR-B R/G RNAXX
6488Ubiquitin solutionXX
6493URNdesignXX
6494BsCM trimerXX
6495BsCM trimerXX
6496BsCM trimerXX
6500Siah-Interacting Protein (Residues 74-178)XX
6501Nsp9 dimerXX
6502XPF/ERCC-1 heterodimerXX
6503apo v-Src SH2XX
6504crambinXX
6510AMA1 Domain IIXX
6511peptide SDXX
6512Vaccinia Virus envelope protein A27LXX
6513non structural protein 7XX
6514PA4608XX
6515At2g46140XX
6516holo-acyl carrier proteinXX
6517PA4738XX
6519CalsensinXX
6520Pcf monomerXX
6524apoE N-terminal domainXX
6525Mungbean Defensin, VrD1XX
6526pXquaXX
6527Km23 homodimerXX
6528CbpAXX
6530CC45XX
6533DNA binding domain of STPAXX
6536hSH3-1 domainXX
65375'-d(CTAACAGAATG)-3'/5'-d(CATTCAGTTAG)-3'/Naphthyridine-Azaquinolone1/Naphthyridine-Azaquinolone2XX
65382B4 monomerXX
6539hSH3-1 domainXX
6541Ca-bound calmodulinXX
6542Arginine kinaseXX
6546CGI-126 monomerXX
6547polyhistidine peptideXX
6551DNA excision repair protein ERCC-1, DNA repair endonuclease XPF (E.C.3.1.-.-)XX
6555protein YBL071w-AXX
6556Programmed cell death protein 5XX
6557preS2 surface antigenXX
6561plantaricin AXX
6563arsenate reductaseXX
6566Measles virus N protein (amino acids 477-505)XX
6567Measles virus N protein (amino acids 477-505) bound to the measles virus P protein (amino acids 457-507)XX
6568Measles virus P protein (amino acids 457-507)XX
6569Measles virus P protein (amino acids 457-507) bound to the measles virus N protein (amino acids 477-505)XX
6571thetaXX
6573vacuolar protein sorting factor 4AXX
6575Nck2 SH2 domainXX
6576monomerXX
6578bcl-xl /Bad BH3 peptide (NLWAAQRYGRELRRMSDEFVDSFKK)complexXX
6579JX EGFR monomerXX
6580socs3 bound to a phosphotyrosine peptideXX
6582ecBMPR-IIXX
6583S100A1 dimerXX
6585At1g24000.1XX
6587apolipoprotein A-IXX
6588apolipoprotein A-I(1-186)XX
6589Chromo domain 1 of cpSRP43XX
6591Phe18Pff and Tyr20Pff AcAMP2 double mutantXX
6592Chromo2 domain of cpSRP43XX
6593Chromo 3 domain of cpSRP43XX
6594Leishmania major FYVE domain containing protein 1XX
6596vhl-1XX
6597Aryl hydrocarbon receptor nuclear translocatorXX
6598Prion-like protein doppelXX
6603ykuVXX
6604v-Src-SH2 complexed with PQpYEEIPIXX
6605NMR ensemble Ada ProteinXXX
6606RPA70A from S.cervisiaeXX
6607JumonjiXX
6608PV5 solution structureXX
6609dendritic cell-derived ubiquitin-like proteinXX
6610apg8aXX
6611receiver domain of NtrC4XX
6615BsLonSSD monomerXX
6616peptide P5XX
6617C-terminal haemopexin-like domain of matrix metalloproteinase MMP-13 (collagenase-3)XX
6618peptide P6XX
6619peptide P7XX
6620p22HBP monomerXX
6621Interleukin-2XX
6622reduced and S-methylated hen egg white lysozymeXX
6623C-peptideXX
6624RA1XX
6625PHPT1XX
6626Plant Tom20XX
6628Set7/9XX
6629Outer membrane usher protein FimDXX
6631Splicing factor 3 subunit 1XX
6635RA2XX
6637AcAMP2F18Nalb mutantXX
6638lmp2a NTDXX
6639AcAMP2F18W mutantXX
6643human prolactinXX
6644assembly AlgHXX
6645hv-DHFR1XX
6646firefly luciferase domain residues 420-550XX
6647AcAMP2F18Wb mutantXX
6648Zap1-monomerXX
6649Sporulation-specific N-acetylmuramoyl-L-alanine amidase (E.C.3.5.1.28)XX
6650St II fragmentsXX
6651St II fragmentsXX
6652GAAA tetraloop/Recptor homodimerXX
6653zzf1LXX
6655Zinc finger domains 1 and 2 of dsRBP-ZFaXX
6656AcAMP2F18Pff/F20Pfff mutantXX
6657AcAMP2F18Nal mutantXX
6658FLIX3XX
6659rubredoxinXX
6660rubredoxin (V8A)XX
6661rubredoxin (V8A)XX
6662rubredoxinXX
6663rubredoxin (V8G)XX
6664rubredoxin (V8G)XX
6665rubredoxin (V8G/V44G)XX
6666rubredoxin (V8G/V44G)XX
6667rubredoxin (V8I)XX
6668rubredoxin (V8I)XX
6669rubredoxin (V8L)XX
6670rubredoxin (V8L)XX
6671rubredoxin (V44A)XX
6672rubredoxin (V44A)XX
6673rubredoxin (V44G)XX
6674rubredoxin (V44G)XX
6675rubredoxin (V44I)XX
6676rubredoxin (V44I)XX
6677rubredoxin (V44L)XX
6678rubredoxin (V44L)XX
6679G311XX
6680A219 monomerXX
6682Zinc finger protein 593XX
6685AlkBXX
6687N-terminal domain of human centrin 2XX
6688Rv1980c (monomer)XX
6689human centrin 1XX
6690PSI AB complex with U1-70k proline-rich peptideXX
6691PSI AB region free proteinXX
6693BoR11XX
6695FNR polypeptideXX
6696PP5-TPR-peptide complexXX
6698MSP2 peptideXX
6700TBP associated factor 1 (TAF1)XX
6702yeast TBP associated factor 1 (yTAF1)XX
6707paramecium calmodulinXX
6714CSP1XX
6715StanninXX
6717Hypothetical UPF0213 protein BH0048XX
6720Alpha-conotoxin PIAXX
6722Low-Molecular-Weight Protein Tyrosine PhosphataseXX
6723soluble apo-CcmEXX
6724Der f 13XX
6725Dengue envelope protein domain IIIXX
6726CalC monomerXX
6727telomeric repeat-binding domain of Arabidopsis thalianaXX
6729DSP monomerXX
6731BofCXX
6736NMR structure of PA2021XX
6738Selenoprotein Sep15XX
6739Selenoprotein MXX
6741Pulmonary surfactant-associated protein BXX
6742ataxin-3 josephin domainXX
6745HnRNP F RRM12XX
6746phnA-like protein rp4479XX
674750S ribosomal protein L40eXX
6748The Ki67FHA/hNIFK(226-269)3P complexXX
6749mSin3B PAH1 and NRSF/RESTXX
6750MYB-KIX-MLL COMPLEXXX
6751Asl1650XX
6752PH-PDZ tandem of alpha-syntrophinXX
6753split PH1 domain of alpha-syntrophinXX
6754PDZ domain of alpha-syntrophinXX
6755TA0743XX
6756D6shortXX
6757membrane anchor domain of BVDV NS5AXX
6758EcCdtB-IIXX
6759NEAT domainXX
6760FRB domainXX
6761UBL1 domain of TUGXX
6762Tor inhibition proteinXX
6763middle domain of human eRF1XX
6766pa0128XX
6769NE2066XX
6776YFHJXX
6777beta PIX-SH3 complexed with an atypical peptide from alpha-PAKXX
6778CaM-melatoninXX
6779Outer membrane usher protein fimDXX
6780hi1506XX
6781ada2 swirm domain polypeptideXX
6782YbiAXX
6783RKIPXX
6784KIDXX
6787rabphilin C2A domainXX
6788Ser133-phosphorylated KIDXX
679018:0 ACP from spinachXX
6793Protein YsneXX
6797OmlAXX
6798CaM-CaMKIXX
6799MrR16XX
6800Domain III of the E protein of Langat flavivirusXX
6801Human SUMO-2 monomerXX
6803FecA N-terminal periplasmic signaling domainXX
6807Maltodextrin-binding protein (MBP)XX
6808N-terminal peptideXX
6809rabbitpox vCCIXX
6810C'-RcsCXX
6811cadmium-transporting ATPase (E.C.3.6.3.3)XX
6820CaltractinXX
6823HRV14-3CXX
6824SARS CoV 7a proteinXX
6827lah4 monomerXX
6828MazF homodimerXX
6829Chitin binding domainXX
6830calmodulinXX
6831CaM-cNOS peptide comlexXX
6832lipase PGXX
6833MazF(E24A)2-MazEp(54-77)2 heterotetramerXX
6834Huntingtin interacting protein B isoform 1XX
6835Fowlicidin 1XX
6837L27 Heterodimer From Lin-7 and Lin-2 Scaffold ProteinsXX
6838PSE-4XX
6839PV5XX
6843Caspase recruitment domain protein 4XX
6844U1 small nuclear ribonucleoprotein AXX
6845Ribosome biogenesis protein Nop10XX
6846H/ACA ribonucleoprotein complex subunit 3XX
6847trxyXX
6850PRP40 FF1XX
6851XPF dimer proteinXX
6855CIN85 B domainXX
6859P2XX
6860BC022030XX
6863Zinc finger domain of Mengovirus Leader polypeptideXX
6864tusp1XX
6866Sorting nexin 22XX
6869DNA polymerase III subunit tauXX
6872kalata B8XX
6873C-PH domainXX
6874CBP-SID domain in complex with SRC1-AD1 domainXX
6876ChagasinXX
6877HPV-16 E2C-DNA complexXXX
6879aKv1.1NXX
6882sushi domain of the interleukin-15 receptorXX
6884YflL monomerXX
6885Ig1 moduleXX
6886lah4XX
6888Neocarzinostatin apo-protein with FlavoneXX
6892lung surfactant protein CXX
6894Ral guanine nucleotide dissociation stimulatorXX
6895PROTEIN/RNA ComplexXXX
6896Alpha-conotoxin ImIXX
6897Alpha-conotoxin ImIXX
6899PAH2 domainXX
6900Pdcd4 C-terminal MA-3 (319-449)XX
6901DUSP DOMAIN OF HUSP1XX
6902hFKBP38DXX
6903M-crystallin Ca2+ free form (APO)XX
6904M-Crystallin Ca2+ loaded (HOLO) monomerXX
6905Zap1 - monomerXX
6906Bicoid Homeodomain Bound to DNAXXX
6907V66W110 fragment of staphylococcal nucleaseXX
6908SNase110 fragment of Staphylococcal NucleaseXX
6911MAGI-1 PDZ1XX
6912yeast thioredoxin 1XX
6913thioredoxin 2XX
6914WILSON DISEASE ATPASEXX
6918Ca2+/CRC-NXX
6919MAN1 655-775 domainXX
6920Midline-1 B-box Type 1XX
6921human cytochrome b5 with oxydized hemeXX
6922Vts1:RNA dimerXXX
6923FKBP38XX
6924discrepin monomerXX
6925Kid toxinXX
6926TSP9XX
6927spinophlin PDZ domainXX
6928PCV2XX
6929NeT3 monomerXX
6930SNF RBD1XX
6932cent-IXX
6933Neurabin PDZXX
6934Wzb monomerXX
6935lipase WTXX
6936VirB7/VirB9XX
6939USP7 N-terminal domain in complex with an EBNA1 peptideXX
6941XAOXX
6942myristoylated NCS-1XX
6943chemosensory protein 1XX
6945PSD-1XX
6949d2 of RAPXX
6950domain 3 of RAPXX
6951Conotoxin pl14aXX
6952Violacin AXX
6953Major prion proteinXX
6954HemagglutininXX
696210:0 ACP from spinachXX
6963Second Kunitz domain of human WFIKKN1XX
6964Rpa2829XX
6965CuA domainXX
6966cytochrome c552XX
6967cytochrome c552XX
6968intrinsically disordered alpha-synucleinXX
6970Rac1.GMPPNP GTPaseXX
6971PDI-b'XX
6972PDI-a'XX
6973human p23(1-119)XX
6974human p23(1-160)XX
6975Bcl2MidG4Pu23-G15T G16TXX
6980BC009474XX
6981BsaLXX
6982TA0895XX
6983heme-heme oxygenase-azide complexXX
6984R1a CBD-AXX
6985Hexim1 TBD dimerXX
6986Phosphotyrosine binding domain of chicken tensin 1XX
6987Heme-heme oxygenase-cyanide complexXX
6988HGB1-UBA monomerXX
6989Ribosomal Protein S24EXX
6990Cerato-plataninXX
6992peptidoglycanXX
7000Rv2302XX
7002Ede1 UBA-ubiquitin complexXX
7003hsp90XX
7004Rpa0253 monomerXX
7005Peptide YYXX
7006Peptide YYXX
7010Merozoite surface protein 1XX
701113-mer peptide from Thermonuclease (E.C.3.1.31.1)XX
701218-mer peptide from Thermonuclease (E.C.3.1.31.1)XX
7013Bcl-xL dimerXX
7014nsp1XX
7015paramecium calmodulinXX
7018CaM-Cys-CaMKIXX
7019nsp3aXX
7020RNA Polymerase II subunitXX
7021LpMipXX
7022DUF589 monomerXX
7023REF2-I double domainXX
7024rabbitpox vCCI:human MIP-1b complexXX
7025VAP-A:OSBP ComplexXX
7032KIV8XX
7033GSPT1/eRF3a(PAM2-2) - PABC complexXX
7034hZHX1-ZNFXX
7035NCK2 2nd SH3XX
7036NCK2 3rd SH3XX
7050MbGBPXX
7051SlGBPXX
7053cysteine catalytic half-domain of mouse E1 proteinXX
7054XCC1710XX
7055PTH monomerXX
7056DPDEXX
7057hbSBD monomerXX
7058MICAL 1 CH monomerXX
7059PyrazinamidaseXX
7061Talin-1XX
7063putative cytoplasmic proteinXX
7064Cycloviolacin O14XX
7065Gaegurin-4XX
7070monomerXX
7071Kis antitoxinXX
7072GOPC PDZ monomerXX
7073PfamXX
7074Zn-saturated Pf0610XX
7075conserved hypothetical protein pa2412XX
7079RP2812XX
7080NTD-CTD complexXX
7082PutA45XX
7083SBDXX
7085hypothetical protein yst6499XX
7086hypothetical protein tm1012XX
7087D4ED3XX
7088IF2 domain III-IVXX
7089Metalloelastase monomerXX
7091GroES heptamerXX
7097brinker CG9653-PA/DNA ComplexXXX
7099wsv230XX
7101Designed protein TOP7XX
7102Designed Protein AYEXX
7103H98S ARDXX
7104F3 module 2 of NCAMXX
7105SRY.B in complex with 16-mer DNAXXX
7106RGS18 monomerXX
7108TrxA monomerXX
7109TrxA monomerXX
7112FBNYV M-Rep (2-95)XX
7115eIF4EXX
7117Hybrid atracotoxinXX
7118Neurabin SAM domain monomerXX
711932324 monomerXX
7120Rho-GTPase-activating protein 7XX
7123BR2XX
7124B-box2 monomerXX
7125HbCO AXX
7126barnase-barstar complexXX
71272F3XX
71281F3-2F3XX
7129SH3 domainXX
7130RhodaneseXX
7131IGF2R domain 11XX
7132CheA P1 domainXX
7133CheA P3P4 domainXX
7134brinker CG9653-PAXX
71352SS(alpha)XX
71362SS(beta)XX
7139free barnaseXX
7140SH2 domain of human CskXX
7141SH2 domain of human Csk with Cbp ligandXX
7142prion proteinXX
7151DLC2-SAM monomerXX
7153Lysozyme LoopXX
71582nd RAN binding zinc finger from hNUP153XX
71592SS[6-127, 30-115]XX
7160metLYZXX
7161Ezrin FERM C ERMAD ComplexXX
7162b' domain of ERp57XX
7166CgNa toxinXX
7167RICH proteinXX
7170sr482 monomerXX
7171tachystatin B1XX
7172C-terminal domain of twinfilinXX
7173tachystatin B2XX
7174Hdm2 RING finger domainXX
7175YorPXX
7176monomeric antimicrobial peptideXX
7178putative chaperoneXX
7186Spider toxin Magi 5XX
7187Ct ole e 9 monomerXX
7189Cj1258 monomerXX
7191pat90 monomerXX
7192YqaIXX
7193PA1123XX
7194TFIIIA zf46 & 5S rRNA complexXXX
7196DHFR-MTX complexXX
7199DHFR-Bdm-4,6 complexXX
7200DHFR-TMP complexXX
7201YqbFXX
7202dSUMOXX
7203HOPXX
7204KP1966 monomerXX
7206human RNase 7XX
7207human zeta-COPXX
7208GpATMXX
7209PilPXX
7210Plant HomeoDomain of ING4XX
7211Erabutoxin b monomerXX
7212J1XX
7213J1ccXX
7214J3XX
7215J7XX
7219hUev1aXX
7220ephrinB2 ectodomain monomerXX
7221Link TSG6 with and without hyaluronan octasaccharidesXX
7222Link TSG6 without hyaluronan octasaccharidesXX
7223Interferon, alpha-inducible proteinXX
7224Phage-like element PBSX protein xkdWXX
7225UPF0291 protein ynzCXX
7226Conserved protein MTH1368XX
7227Hypothetical protein yppEXX
7228UPF0107 protein AF0055XX
7231Heme-binding protein 1XX
7235beta phosphoglucomutaseXX
7236Mutants Y105W of TEM-1 beta-lactamaseXX
7237Mutants Y105G of TEM-1 beta-lactamaseXX
7238Mutants Y105N of TEM-1 beta-lactamaseXX
7239Mutants Y105D of TEM-1 beta-lactamaseXX
7240scPCNA trimerXX
7244gamma-synuclein monomerXX
7245TM VII of Na+/H+ exchangerXX
7246PEBP2alpha DNA binding domainXX
7247di-Zn(II) DFscXX
7248Mesd(12-155)XX
7249His-15.5KXX
7251p53 tetramerization domainXX
7252p53 tetramerization domainXX
7253p53 tetramerization domainXX
7254p53 tetramerization domainXX
7255p53 tetramerization domainXX
7256Hydrogenase-1 operon protein hyaEXX
7257RRM domain of SR rich factor 9G8XX
7259DNA polymerase mu (E.C.2.7.7.7)XX
7260YjcQ proteinXX
7261Hypothetical protein ykfFXX
72621-45IGFBP-6XX
7263Meg-A12XX
7266NE1680XX
7269fivar docXX
7270x82XX
7271AF2241XX
7272RGS10XX
7273Jingzhaotoxin-3XX
7274Hypothetical protein YdfOXX
7276Blo t 5XX
7277dG85 ttRNHXX
7278iG80b ecRNHXX
7279HMGA1XX
7280GB1 domainXX
7281protein yjbR monomerXX
7282MHA6XX
7283MHB4AXX
7284MHB8AXX
7285double dockerinXX
7286CG7054XX
7288BNIP3 TM dimerXX
7293recoverin bound to rhodopsin kinase fragment (RK25)XX
7294bacillomycin LcXX
7295Synthetic Cyclo Peptide (SCP)XX
7297conserved hypotetical protein RPA1320XX
7298Znf-UBP domain of Ubp-MXX
7300COMMD1 N-terminal domainXX
7301SF2/ASF RRM2XX
7303NIXXX
7304pMSPXX
7305R21A Spc-SH3 monomerXX
7306R21A Spc-SH3 monomerXX
7310cyclophilin DXX
7316MonomerXX
7317MonomerXX
7318MonomerXX
7319polyermase beta in complex with substrate DNAXXX
7320PufXXX
7321LDLa module of RXFP1XX
7322apo-oncomodulinXX
7323Colicin immunity protein IM2XX
7324SelWXX
7325yDcp2(100-245)XX
7326En-1 monomerXX
7327En-2XX
7339MLP-like protein 28XX
7340DAGK homotrimerXX
7342NUCLEOCAPSID PROTEINXX
7351KIAA0252 PROTEINXX
7352GAG POLYPROTEINXX
7356Rat intestinal fatty acid binding proteinXX
7357Rat intestinal fatty acid binding proteinXX
7358rmBG21XX
7359DsbA oxidoreductaseXX
7360DsbA oxidoreductaseXX
7362UPF0165XX
7365WW domainXX
7366Periplasmic proteinXX
7367L-22XX
7371SiR5XX
7376CzrAXX
7377CzrAXXX
7381Alr1010 proteinXX
7382Nucleolar protein 3XX
7383Nucleolar protein 3XX
7387PIP 18XX
7388pip17XX
7389pip9XX
7390CcV28C AdxL80CXX
7391GCN4XX
7395RWD/GI domainXX
7406ccc2XX
7407MxiDXX
7408HMGB1, ABprimeXX
7409HMGB1, delta5XX
7410HMGB1, delta10XX
7411HMGB1, delta15XX
7412HMGB1, delta20XX
7413HMGB1, delta25XX
7414MMP12 HUMANXX
7415MMP12 HUMANXX
7422Galectin-3-LBTXX
7428KcsAXX
7429Phosphotyrosine-Binding Domain of Insulin Receptor Substrate-1 Monomer complex with Interleukin-4 Receptor PhosphopeptideXX
7430ERp18XX
7432IscU(D39A)XX
74343F5 PABPN1pept complexXX
7435HVS ORF57/REF2-I complexXX
9500troponin complexXX
10001mastoparan-XXX
100042'-5' RNA ligase-like proteinXX
10005ChiC ChBDXX
10006FN3 domain of HYPOTHETICAL PROTEINXX
10008C-terminal FN3 domain of 1700129L13Rik proteinXX
10009SH3 domain of mouse Kalirin-9a proteinXX
10010bovine beta-lactoglobulin A34C; disulfide linked dimerXX
10011the SWIRM domain of human LSD1XX
10012troponin complexXX
10013ring finger domain of KIAA1045 proteinXX
10014helix6 in SRP RNAXX
10015integrase Zn finger domain mutantXX
10016ABCB6-CXX
10017ABCB6-C-ADPXX
10018RNA hairpin of eel LINEXX
10019GSPT1/eRF3a(PAM2-1) - PABC complexXX
10021FoF1 ATP synthaseXX
10022K3 peptide of beta2-microglobulinXX
10023se-heIF2alphaXX
10025MAP/microtubule affinity-regulating kinase 3XX
10026MAP/microtubule affinity-regulating kinase 3XX
10027DnaAXX
10028the second WW domain of mouse salvador homolog 1 protein (mWW45)XX
10029membrane associated guanylate kinase inverted-2XX
10030T-plastinXX
10031KIAA1617 proteinXX
10032KIAA1798 proteinXX
100331700030A21Rik proteinXX
10034KIAA0970 proteinXX
10035Hypothetical protein yk1067a12XX
10036Protein CGI-38XX
10037KIAA1798 proteinXX
10038Zinc finger protein 295XX
10039FYVE, RhoGEF and PH domain containing 6; ethanol decreased 4XX
10040Growth factor receptor-bound protein 7XX
10041MYST histone acetyltransferase 1XX
10042KIAA1068 proteinXX
10043Signal Recoginition Particle 54XX
10044ZF-HD homeobox family proteinXX
10045ZF-HD homeobox family proteinXX
10046Mitogen activated protein kinase kinase 5XX
10047Homeobox leucine zipper protein HomezXX
10048Tudor domain containing protein 3XX
10049Transcription elongation factor S-II protein 3XX
10050NEDD8 ultimate buster-1XX
10051RasY32WXX
10052PCP homo tetramerXX
10053OppAXX
10054UNR proteinXX
10055Glia maturation factor gammaXX
10056regulator of G-protein signaling 14; rap1/rap2 interacting proteinXX
10057nitrogen fixation cluster-likeXX
10058Thioredoxin-like protein 2XX
10059Flotillin 2XX
10060C330018D20rik proteinXX
10061Cypher proteinXX
10063Intersectin 2XX
10064MEMBRANE ASSOCIATED GUANYLATE KINASE INVERTED-2 (MAGI-2)XX
10065putative nuclear protein homolog 5830484A20RikXX
10066KIAA1526 proteinXX
10067expressed proteinXX
10068TransgelinXX
10069actin-binding LIM protein homologueXX
10070Heterogeneous nuclear ribonucleoprotein H'XX
10071RNA-binding protein RalyXX
10072Heterogeneous nuclear ribonucleoproteins C1/C2XX
10073putative elicitor-responsive geneXX
10074synaptotagmin XIIIXX
10075sidekick 2XX
10076sidekick 2XX
10077Eukaryotic translation initiation factor 4BXX
10078LolA monomerXX
10079KIAA0561 proteinXX
10080putative 42-9-9 proteinXX
10081rhophilin, Rho GTPase binding protein 2XX
10082calcipressin 1XX
10083Regulating synaptic membrane exocytosis protein 2XX
10084nuclear distribution gene C homologXX
10085Heterogeneous nuclear ribonucleoprotein HXX
10086Rap guanine nucleotide exchange factor 5XX
1008759 kDa 2'-5'-oligoadenylate synthetase like proteinXX
10088KIAA0147 proteinXX
10089Numb proteinXX
10090hypothetical protein F20O9.120XX
10091Tubulin-folding protein TBCEXX
10092interleukin-1 receptor-associated kinase 4XX
10093Homeobox protein Cux-2XX
10094Homeobox protein Cux-2XX
1009540S ribosomal protein S3XX
10096LolB monomerXX
10097SH3 domain-binding glutamic acid-rich-like protein 3XX
10098Diacylglycerol kinase, deltaXX
10099KIAA1568 ProteinXX
10100Membrane Associated Guanylate Kinase Inverted-2 (MAGI-2)XX
101012610208M17Rik proteinXX
10102KIAA1568 proteinXX
10103KIAA0147 proteinXX
10104polynucleotide kinase 3'-phosphataseXX
10105hypothetical protein RAFL11-05-P19XX
10106hypothetical protein RAFL09-47-K03XX
10107microtubule-associated protein, RP/EB family, member 1XX
10108PDI-like Hypothetical Protein At1g60420XX
10109Glutamate Receptor Interacting Protein 1A-L HomologXX
10110Growth-arrest-specific protein 2XX
10111Nucleolar transcription factor 1XX
10112DNA segment, Chr 7, Wayne State University 128, expressedXX
10113SH2 and PH domain-containing adapter protein APSXX
10114SET binding factor 1XX
10115Oxysterol binding protein-related protein 8XX
10119KIAA0730 proteinXX
10120Lamin AXX
10121immature colon carcinoma transcript 1XX
10122Intersectin 2XX
10123Hepatoma-derived growth factor, related protein 3XX
10124MEMBRANE ASSOCIATED GUANYLATE KINASE INVERTED-2 (MAGI-2)XX
10125hypothetical protein RIKEN cDNA 2310016K04XX
10126Hypothetical KIAA1002 proteinXX
10127hypothetical PNPaseXX
10128second FNIII domain of DSCAML1 proteinXX
10129sidekick 2 proteinXX
10130NPL4 family proteinXX
10131pleckstrin homology domain-containing, family AXX
10132cytochrome c551XX
10133cytochrome c551XX
10134cytochrome c552XX
10135cytochrome c552XX
10136Intersectin 2XX
10137Lipocalin-type Prostaglandin D synthaseXX
10138Probable 16S rRNA-processing protein rimMXX
10139RimMXX
10140RimM complexed to S19XX
10141AP-1 complex subunit gamma-2XX
10142Filamin-BXX
10143Filamin-BXX
10144Rho GTPase activating protein 5 variantXX
10145Rho GTPase activating protein 5 variantXX
10146Filamin-BXX
10147Sperm flagellar protein 1XX
10148Protein odd-skipped-related 2XX
10149Protein MICAL-2XX
10150SPCC24B10.08c proteinXX
10151Zinc finger protein 268XX
10152Zinc finger protein 268XX
10153Zinc finger protein 484XX
10154Zinc finger protein 473XX
10155Zinc finger protein 484XX
10156Zinc finger protein 484XX
10157B-cell lymphoma 6 proteinXX
10158Zinc finger protein 473XX
10159Filamin-BXX
10160Filamin-BXX
10161Filamin-BXX
10162Filamin-BXX
10163Filamin-BXX
10164Uncharacterized protein C6orf130XX
10165Protein phosphatase 1, regulatory (Inhibitor) subunit 3BXX
10166Zinc finger protein 268XX
10167Zinc finger protein 28 homologXX
10168Zinc finger protein 28 homologXX
10169Zinc finger protein 224XX
10170Zinc finger protein 28 homologXX
10171Zinc finger protein 224XX
10172Zinc finger protein 224XX
10173Zinc finger protein 347XX
10174Zinc finger protein 347XX
10175Zinc finger protein 28 homologXX
10176Zinc finger protein 28 homologXX
10177Zinc finger protein 484XX
10178Zinc finger protein 473XX
10179Zinc finger protein 28 homologXX
10180Zinc finger protein 224XX
10181Zinc finger protein 224XX
10182Zinc finger protein 473XX
10183Zinc finger protein 484XX
10184Zinc finger protein 484XX
10185Zinc finger protein 268XX
10186Zinc finger protein 95 homologXX
10187Zinc finger protein 224XX
10188Zinc finger protein 347XX
10189Zinc finger protein 95 homologXX
10190Zinc finger protein 95 homologXX
10191Zinc finger protein 268XX
10192Zinc finger protein 224XX
10193Zinc finger ZZ-type-containing protein 3XX
10194RUN and TBC1 domain containing 3XX
10195VinexinXX
10196Zinc finger protein 95 homologXX
10197Zinc finger protein 224XX
10198Zinc finger protein 224XX
10199Zinc finger protein 347XX
10200Zinc finger protein 473XX
10201Zinc finger protein 473XX
10202Zinc finger protein 484XX
10203Zinc finger protein 484XX
10204Zinc finger protein 28 homologXX
10205Zinc finger protein 28 homologXX
10206Zinc finger protein 28 homologXX
10207Zinc finger protein 347XX
10208Zinc finger protein 473XX
10209Zinc finger protein 473XX
10210Zinc finger protein 28 homologXX
10211Tyrosine-protein kinase ITK/TSK (E.C.2.7.10.2)XX
10212SRC-like-adapterXX
10213ATP-dependent RNA helicase DDX50 (E.C.3.6.1.-)XX
10214Membrane-associated guanylate kinaseXX
10215Membrane-associated guanylate kinaseXX
10216Zinc finger protein 268XX
10217Zinc finger protein 268XX
10218Zinc finger protein 268XX
10219Zinc finger protein 268XX
10220Zinc finger protein 95 homologXX
10221Zinc finger protein 224XX
10222Zinc finger protein 268XX
10223Zinc finger protein 347XX
10224Zinc finger protein 268XX
10225Zinc finger protein 268XX
10226Zinc finger protein 268XX
10227Zinc finger protein 268XX
10228Zinc finger protein 95 homologXX
10229Zinc finger protein 268XX
10230Zinc finger protein 224XX
10231B-cell lymphoma 6 proteinXX
10232Zinc finger protein 95 homologXX
10233Zinc finger protein 347XX
10234Zinc finger protein 347XX
10235amyloid beta (A4) precursor protein-bindin, family B, member 2XX
10236peptide from Amyloid beta A4 protein, Amyloid beta A4 precursor protein-binding family B member 2XX
10237Amyloid beta A4 precursor protein-binding family B member 2 and Amyloid beta A4 proteinXX
10238Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 2XX
10239Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 2XX
10240cortactin isoform aXX
10241Rho guanine exchange factor (GEF) 16XX
10242Interleukin-16XX
10243Zinc finger protein 24XX
10244Zinc finger protein 462XX
10245Megakaryocyte-associated tyrosine-protein kinaseXX
10246Transcriptional repressor CTCFXX
10247NEDD9 interacting protein with calponin homology and LIM domainsXX
10248HMG-BOX transcription factor BBXXX
10249PleckstrinXX
10250Signal-transducing adaptor protein 1XX
10251Pleckstrin 2XX
10252thymus high mobility group box protein TOXXX
10253Protein kinase C, D2 typeXX
10254FYVE, RhoGEF and PH domain containing protein 3XX
10255ARAP2 proteinXX
10256Hypothetical protein KIAA1914XX
10257Zinc finger BED domain-containing protein 2XX
10258Ephrin type-B receptor 1XX
10259human unnamed protein productXX
10260Receptor-type tyrosine-protein phosphatase FXX
10261Methionyl-tRNA synthetaseXX
10262Collagen alpha-1(XX) chainXX
10263Receptor-type tyrosine-protein phosphatase FXX
10264signal transducing adaptor molecule 2XX
10265Protein tyrosine phosphatase, receptor type, FXX
10266Receptor-type tyrosine-protein phosphatase FXX
10267PDZ domain-containing protein 1XX
10268Protocadherin-9XX
10269Chromodomain helicase-DNA-binding protein 4XX
10270Contactin-1XX
10271Collagen alpha-1(XX) chainXX
10272SH3 and PX domain-containing protein 2AXX
10273Developmentally-regulated GTP-binding protein 1XX
10274Collagen alpha-1(XX) chainXX
10275PAAD DAPIN, UNP residues 8-88XX
10276Tudor domain-containing protein 3XX
10277Chromobox protein homolog 2 (isoform 2)XX
10278Pleckstrin homology domain-containing protein family B member 1XX
10279Docking protein 2XX
10280Oxysterol binding protein-related protein 11XX
10281Paired box protein Pax6XX
10282FLJ21616 proteinXX
10283Alpha-fetoprotein enhancer binding proteinXX
10284Alpha-fetoprotein enhancer binding proteinXX
10285Alpha-fetoprotein enhancer binding proteinXX
10286Hypothetical protein DKFZp686K21156XX
10287Zinc fingers and homeoboxes protein 3XX
10288Hepatocyte nuclear factor 1-betaXX
10289Zinc finger homeobox protein 1bXX
10290Homeobox protein DLX-5XX
10291Homeobox protein TGIF2LXXX
10292Zinc fingers and homeoboxes protein 2XX
10293LIM/homeobox protein Lhx9XX
10294Homeobox protein OTX2XX
10295Homeobox protein BarH-like 1XX
10296Homeobox protein goosecoidXX
10297Transcription factor 8XX
10298Homeobox and leucine zipper protein HomezXX
10299Tripartite motif protein 9, isoform 2XX
10300Proto-oncogene tyrosine-protein kinase MER precursorXX
10301Crk-like proteinXX
10302SH3-containing GRB2-like protein 2XX
10303Zinc finger protein 28 homologXX
10304Zinc finger protein 95 homologXX
10305Zinc finger protein 347XX
10306B-cell lymphoma 6 proteinXX
10307Zinc finger protein 473XX
10308Zinc finger protein 473XX
10309Zinc finger protein 484XX
10310Zinc finger protein 347XX
10311Pleckstrin homology domain-containing protein family A member 6XX
10312Solution structure of the PH domain of Protein kinase C, nu type from humanXX
10313130-kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating proteinXX
10314Pleckstrin homology domain-containing family B member 2XX
10315Rho GTPase activating protein 21XX
10316TBC1 domain family member 2XX
10317Pleckstrin homology domain-containing family A member 5XX
10318KIAA1075 proteinXX
10319KIAA0640 proteinXX
10320Filamin-BXX
10321Filamin-BXX
10322Filamin-BXX
10323Filamin-BXX
10324Filamin-BXX
10325Filamin-BXX
10326Filamin-BXX
10327Tripartite motif protein 45XX
10328Filamin-CXX
10329Filamin-CXX
10330Filamin-CXX
10331Filamin-CXX
10332Filamin-CXX
10333BK158 1XX
10334Filamin-BXX
10335Filamin-BXX
10336Thioredoxin-like protein 1XX
10337Suppressor of T-cell receptor signaling 1XX
10338Ubiquitin carboxyl-terminal hydrolase 5XX
11000ATP Synthase Epsilon ChainXX
11002antimicrobial peptide RP-1XX
11003antimicrobial peptide RP-1XX
11004Ebola fusion peptideXX
11005Bent alpha-helixXX
11007FBP28WW2-PTPPPLPPXX
11008FBP28WW2-PPPLIPPPPXX
11009Dm LSm16 monomerXX
11010Rac1/HR1b complexXX
11013dynein heavy chainXX
11016LysargXX
11017TnpE proteinXX
11018Itk SH3XX
11019Cox17 monomerXX
11020Cu(I)Cox17XX
11021CLN025XX
11022big defensin monomerXX
11024VRAR DNA binding domainXX
11026SHA (single chain polypeptide)XX
11027SH3-F2 (single chain polypeptide)XX
11031pHtrIIXX
11032the knotted tudor domainXX
11033the presumed chromodomainXX
11035TTHA1718XX
11037TTHA1718XX
11038The DNA binding domain of RTBP1XX
11043SHH (single chain polypeptide)XX
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110475'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
11053the West Nile virus NS2B(K96A)-NS3 proteaseXX
11054insect chemokineXX
11055Grb2 SH2XX
11056peptide from V-ATPaseXX
11057the microtubule-binding domain of dynein heavy chain 9XX
11058pituitary adenylate cyclase-activating polypeptide (PACAP)XX
11059pituitary adenylate cyclase-activating polypeptide (PACAP)XX
11061APOBEC2XX
11062lipocalin-type prostaglandin D synthaseXX
11063Polymyxin b resistant protein DXX
110654.1R FERM alpha-lobe domainXX
11067GIRK1 tetramerXX
110681-23 GBPXX
110691-28 GBPXX
110701-28 GBPXX
11072big-NXX
11074the F1-ATPase in the F1 complexXX
11076MESD core regionXX
11077HPFXX
11078Myeloid differentiation primary response protein MyD88XX
11080CsPinXX
11083Acidic leucine-rich nuclear phosphoprotein 32 family member BXX
11084Calponin-2XX
11085NEDD9 interacting protein with calponin homology and LIM domainsXX
11086Microtubule-associated protein RP/EB family member 3XX
11087Unc-112-related protein 2XX
11088Dynamin-2XX
11089Pleckstrin homology domain-containing family A member 6XX
11090Hydrocephalus-inducing protein homologXX
11091HYDIN proteinXX
11092Mortality factor 4-like protein 1XX
11093Tyrosine-protein kinase ITK/TSK (E.C.2.7.10.2)XX
11094Fibroblast growth factor receptor substrate 3, ALK tyrosine kinase receptorXX
11095Fibroblast growth factor receptor substrate 3 and ALK tyrosine kinase receptorXX
11096Netrin receptor DCCXX
11097Netrin receptor DCCXX
11098Netrin receptor DCCXX
11099Netrin receptor DCCXX
11100Protein disulfide-isomerase A6XX
11101Protein disulfide-isomerase A4XX
11102Protein disulfide-isomerase A3XX
11103Netrin receptor DCCXX
11104Protein disulfide-isomerase A4XX
11105Thioredoxin-related transmembrane protein 2XX
11106midline 2 isoform 2XX
11107Thioredoxin domain-containing protein 5XX
11108Thioredoxin-like protein 2XX
11109Protein disulfide-isomerase A4XX
11110Tenascin-XXX
11111NeogeninXX
11112NeogeninXX
11113Thioredoxin domain containing protein 1XX
11114Protein disulfide-isomeraseXX
11115Complex structure of the zf-CW domain and the H3K4me3 peptideXX
11116Protein disulfide-isomerase A6XX
11117Ephrin type-A receptor 1XX
11118NeogeninXX
11119NeogeninXX
11120NeogeninXX
11121NeogeninXX
11122Smooth muscle cell associated protein-1, isoform 2XX
11123SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1XX
11124Calponin 1XX
11125Fibronectin type-III domain containing protein 3aXX
11126Spectrin beta chain, brain 2XX
11127biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding proteinXX
11128biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding proteinXX
11129Rho guanine nucleotide exchange factor 6XX
11130Zinc finger protein 512XX
11131Zinc finger, FYVE domain containing 27 isoform bXX
11132novel proteinXX
11133L-plastinXX
11134WD repeat and HMG-box DNA binding protein 1XX
11135VigilinXX
11136VigilinXX
11137VigilinXX
11138VigilinXX
11139VigilinXX
11140final001XX
11141Vav-3 proteinXX
11142Smoothelin splice isoform L2XX
11143Protein MICAL-3XX
11144Williams-Beuren syndrome chromosome region 18 proteinXX
11145EHBP1 proteinXX
11146Eukaryotic translation initiation factor 5XX
11147High mobility group protein B1XX
11148Nuclear factor of activated T-cells, cytoplasmic 4XX
11150Ectonucleotide pyrophosphatase/phosphodiesterase family member 1XX
11151Protein kinase C delta typeXX
11152Integrin beta-4XX
11153130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating proteinXX
11154Sorbin and SH3 domain-containing protein 1XX
11155Abl interactor 2XX
11156NostrinXX
11157Cytoplasmic tyrosine-protein kinase BMXXX
11158Transcription factor SOX-17XX
11159Retinoblastoma-binding protein 6XX
11160Myeloid/lymphoid or mixed-lineage leukemia protein 3 homologXX
11161Tripartite motif-containing protein 30XX
11162RING finger protein 126XX
11163Tripartite motif-containing protein 5XX
11164TNF receptor-associated factor 3XX
11165Zinc finger protein 268XX
11166Zinc finger protein 268XX
11167Zinc finger protein 347XX
11168Zinc finger protein 347XX
11169Zinc finger protein 484XX
11170Zinc finger protein 484XX
11171Zinc finger protein 484XX
11173Ubiquitin carboxyl-terminal hydrolase 5XX
11176AML22XX
11177RecOXX
11178Olygophrenin-1 like proteinXX
11179SH3-domain kinase binding protein 1XX
11180RIM binding protein 2XX
11181KIAA1496 proteinXX
11182Regulating synaptic membrane exocytosis protein 1XX
11183RIM binding protein 2XX
11184RIM binding protein 2XX
11185RIM binding protein 2XX
11186InaD-like proteinXX
11187InaD-like proteinXX
11188InaD-like proteinXX
11189InaD-like proteinXX
11190InaD-like proteinXX
11191InaD-like proteinXX
11192Myosin binding protein C, fast-typeXX
11193SH3 and PX domain-containing protein 2AXX
11194SH3 and PX domain-containing protein 2AXX
11195Rho guanine nucleotide exchange factor 11XX
11196Uncharacterized protein KIAA1666XX
11197InaD-like proteinXX
11198synapse-associated protein 102XX
11199Enigma homologue proteinXX
11200MAGUK p55 subfamily member 5XX
11201KIAA1095 proteinXX
11202Neurabin-IXX
11203Calcyclin-binding proteinXX
11204HarmoninXX
11205Zinc finger protein 435XX
11206Glutamate receptor interacting protein 2XX
11207LAP4 proteinXX
11208Ephrin type-A receptor 8XX
11209SH3 domain GRB2-like protein B1XX
11210amyloid beta (A4) precursor protein-binding, family A, member 1 (X11)XX
11211Myosin-binding protein C, slow-typeXX
11212Myosin-binding protein C, slow-typeXX
11213SH3YL1 proteinXX
11214SH3 domain of Fyn-related kinaseXX
11215T-cell lymphoma invasion and metastasis 1 variantXX
11216PDZ domain containing protein 1XX
11217SH3 domain of Stac proteinXX
11218CIDE-N domain of human cell death activator CIDE-AXX
11219Sorbin and SH3 domain-containing protein 1XX
11220second SH3 domain of human KIAA0769 proteinXX
11221Ig-like domain of Obscurin-like protein 1XX
11222first SH3 domain of human KIAA0769 proteinXX
11223Leucine-rich repeat-containing protein 4XX
11224Phospholipase C, gamma 2XX
11225SLIT-ROBO Rho GTPase-activating protein 2XX
11226MAGUK p55 subfamily member 2XX
11227Ephrin type-B receptor 4XX
11228Rho guanine nucleotide exchange factor 9XX
11229Obscurin-like protein 1XX
11230ObscurinXX
11231KIAA1837 proteinXX
11232Protein KIAA0319XX
11233KIAA1783 proteinXX
11234Tripartite motif-containing protein 31XX
11235Myosin-binding protein C, fast-typeXX
11236Myosin light chain kinase, smooth muscleXX
11237Myeloid/lymphoid or mixed-lineage leukemia protein 3 homologXX
11238Zinc finger protein 473XX
11239Zinc finger protein 473XX
11240Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrialXX
11242VinexinXX
11244Nuclear receptor corepressor 1XX
11245ubiquitin-like 5XX
11246Afadin 6XX
11247Ubiquitin ligase protein RNF8XX
11248LIM domain kinase 2XX
11249holo GrxS14XX
11251Zinc finger FYVE domain-containing protein 21XX
11252HRDC domain from Bloom syndrome proteinXX
112531700011N24Rik proteinXX
11254cytoskeleton-associated protein 1XX
11255Nuclear receptor coactivator 5XX
11256Ubiquitin carboxyl-terminal hydrolase 14XX
11257ubiquitin-like 3XX
11258RIKEN cDNA 2900073H19 proteinXX
11259Toll-interacting proteinXX
11260ubiquitin associated proteinXX
11261Ubiquilin 3XX
11262RIKEN cDNA 4931431F19XX
11263HLA-B associated transcript-3 isoform bXX
11264AfadinXX
11265A-Raf proto-oncogene serine/threonine-protein kinaseXX
11266Np95-like ring finger protein, isoform aXX
11267Ubiquitin-like protein SMT3BXX
11268Ubiquitin-like protein SB132XX
11269KIAA0733 proteinXX
11270FLJ35834 proteinXX
11271Ubiquilin-3XX
11272KIAA0977 proteinXX
11273Protein KIAA0794XX
11274ETEA proteinXX
11275poly (ADP-ribose) polymerase family, member 10 variantXX
11276CUE domain-containing protein 1XX
11277Rap guanine nucleotide exchange factor (GEF)-like 1XX
11278Activating signal cointegrator 1 complex subunit 2XX
11279Ubiquitin-like protein 4AXX
11280Synaptic glycoprotein SC2XX
11281UBX domain-containing protein 2XX
11282Protein FAM100BXX
11283FAS-associated factor 1XX
11284Hypothetical protein FLJ21522XX
11285peroxisomal biogenesis factor 13XX
11286Synapse associated protein 1XX
11287Zinc finger protein 292XX
11288Fibronectin type-III domain containing protein 3aXX
11289LeupaxinXX
11290Fibronectin type-III domain containing protein 3aXX
11291myosin binding protein C, fast-typeXX
11292Receptor-type tyrosine-protein phosphatase deltaXX
11293Cysteine-rich protein 2XX
11294RWD domain containing protein 2XX
11295Protein C21orf6XX
11296RING finger protein 25XX
11297Lamin-B receptorXX
11298TFIIH basal transcription factor complex p62 subunitXX
11299Proline-serine-threonine phosphatase-interacting protein 1XX
11300Cell division cycle 5-like proteinXX
11301Cell division cycle 5-like proteinXX
11302Zinc finger protein 64, isoforms 1 and 2XX
11303RING finger protein 25XX
11304Neural cell adhesion molecule 2XX
11305Actin Binding LIM Protein 2XX
11306Deltex protein 2XX
11307KIAA0161 proteinXX
11308Protein arginine N-methyltransferase 3XX
11309Cell growth regulating nucleolar protein LYARXX
11310phosphoacetylglucosamine mutaseXX
11311Transforming growth factor-beta induced protein IG-H3XX
11312Zinc finger protein 64, isoforms 1XX
11313Zinc finger protein 183-like 1XX
11314Synaptotagmin-like protein 4XX
11315Non-SMC element 1 homologXX
11316Transcriptional repressor CTCFXX
11317Tripartite motif protein 32XX
11318Cdc42-interacting protein 4XX
11319Zinc finger BED domain containing protein 1XX
11320sh3 domain-binding glutamic acid-rich-like protein 2XX
11321RING finger protein 31XX
11322KIAA1915 proteinXX
11323Zinc finger MYND domain containing protein 10XX
11324THAP domain-containing protein 2XX
11325cellular modulator of immune recognitionXX
11326RING finger protein 146XX
11327Ubiquitin ligase TRIM63XX
11328Zinc finger FYVE domain-containing protein 19XX
11329Possible global transcription activator SNF2L2XX
11330Paf1/RNA polymerase II complex componentXX
11331Midline-2XX
11332Polycomb group RING finger protein 6XX
11333RING finger and CHY zinc finger domain-containing protein 1XX
11334PHD finger protein 3XX
11335Cell growth regulator with RING finger domain protein 1XX
11336RING finger protein 4XX
11337RWD domain-containing protein 3XX
11338RWD domain-containing protein 1XX
11339Baculoviral IAP repeat-containing protein 4XX
11340TNF receptor-associated factor 6XX
11341Tripartite motif-containing protein 39XX
11342RING-box protein 2XX
11343RING finger and CHY zinc finger domain-containing protein 1XX
11344RING finger protein 141XX
11345Transcriptional adapter 2XX
11346Tumor necrosis factor receptor superfamily member 12AXX
11347PHD finger protein 21AXX
11348KIAA1787 proteinXX
11349Skeletal muscle LIM-protein 3XX
11350Skeletal muscle LIM-protein 3XX
11351Protein neuralizedXX
11352inhibitor of growth family, member 1-likeXX
11353Inhibitor of growth protein 3XX
11354inhibitor of growth family, member 4 ING1-like proteinXX
11355Pre-mRNA-splicing factor 18XX
11356Rho guanine nucleotide exchange factor 6XX
11357Transcription elongation regulator 1XX
11358Zinc finger CW-type PWWP domain protein 1XX
11359Zinc finger CW-type PWWP domain protein 1XX
11360Zinc finger CW-type PWWP domain protein 1XX
11361Zinc finger CW-type PWWP domain protein 1XX
11362Zinc finger CW-type PWWP domain protein 1XX
11363Zinc finger HIT domain containing protein 2XX
11364Splicing factor 3 subunit 1XX
11365PROTEINXX
11366spliceosomal protein complex p14-SF3b155XX
11367spliceosomal protein SF3b155XX
11368Zinc finger protein 95 homologXX
11369Zinc finger protein 224XX
11370Tia1 proteinXX
11371Tia1 proteinXX
11372Tia1 proteinXX
11373Tia1 proteinXX
11374Tia1 proteinXXX
11375Tia1 proteinXXX
11376Tia1 proteinXX
11377POZ-, AT hook-, and zinc finger-containing protein 1XX
11378POZ-, AT hook-, and zinc finger-containing protein 1XX
11379POZ-, AT hook-, and zinc finger-containing protein 1XX
11380POZ-, AT hook-, and zinc finger-containing protein 1XX
11381Zinc finger protein 32XX
11382Zinc finger protein 32XX
11383Zinc finger protein 268XX
11384Zinc finger protein 268XX
11385Zinc finger protein 28 homologXX
11386Zinc finger protein 347XX
11387Zinc finger protein 347XX
11388Jumonji, AT rich interactive domain 1BXX
11389Jumonji/ARID domain-containing protein 1DXX
11390Ankyrin-1XX
11391Zinc finger protein 268XX
11392Zinc finger protein 28 homologXX
11393Zinc finger protein 347XX
11394Zinc finger protein 347XX
11395Zinc finger protein 224XX
11396Zinc finger protein 484XX
11397Kelch repeat and BTB domain-containing protein 4XX
11398HYPOTHETICAL PROTEIN (RIKEN cDNA 2810455B10)XX
11399PTB-like protein LXX
11400Arginine/serine-rich splicing factor 10XX
11401Protein kinase C gamma typeXX
11402Chromodomain-helicase-DNA-binding protein 6XX
11403Zinc finger protein 32XX
11404Rho GTPase-activating protein 4XX
11405CUG-BP- and ETR-3-like factor 1XX
11406CUG-BP- and ETR-3-like factor 1XXX
11407CUG-BP- and ETR-3-like factor 1XXX
11408CUG-BP- and ETR-3-like factor 1/RNA ComplexXXX
11409cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11410cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11411cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11412cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11413cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXX
11414zinc finger-containing protein 1XX
11415Zinc finger protein 32XX
11416Zinc finger protein 32XX
11417DnaJ homolog subfamily B member 8XX
11419vasoactive intestinal peptideXX
11420Vasoactive intestinal peptideXX
11422CTP pyrophosphohydrolaseXX
11423Flagellar hook-length control proteinXX
11424tight junction protein ZO-1XX
11425SPFH domain of human stomatinXX
11426Probable SecDF protein-export membrane proteinXX
11429HMGB2 A-domainXX
11430HMGB2 B-domainXX
11431HMGB2 B-domain (H22Y)XX
11434Ostrich egg white lysozymeXX
11435Amyloid-beta-(1-40)XX
11436E73A mutant of Ostrich egg white lysozymeXX
11437Propylene-DNAXX
11438ProteinXX
11441Bryum coronatum chitinaseXX
11442Hd3a (K31A/E57A)XX
11450RNA-binding protein Musashi homolog 1XXX
11451peptidyl-prolyl cis-trans isomeraseXX
11454QB domain of Sp1XX
11466Bryum coronatum chitinase E61A mutantXX
11467Family GH19 chitinase from Rye seedsXX
11470homodimerXX
11471FKBP12-mTOR FRB domain-rapamycin complex structureXX
11472WWE domain in RNF146 with ATPXX
11473CERT PH domainXX
11489RNA aptamer against prion proteinXXX
11490Microtubule-binding domainXX
11492monomerXX
11493Streptomyce sp. N174 chitosanaseXX
11494E22A mutant of Streptomyces sp. N174 chitosanaseXX
11495Microtubule-binding domainXX
11496the chromodomain of Chp1 in complex with H3K9me3 peptideXX
11497the chromodomain of Swi6XX
11498Unique and SH3 domains of mouse LckXX
11499WWEXX
11500PARP11 WWE domainXX
11501PARP14 WWEXX
11504SPOC domain of the human transcriptional corepressor SHARP in complex with SMRTXX
11506human full-length vaccinia related kinase 1 (VRK1)XX
11507an inhibitor protein of DL-endopeptidasesXX
11511structure specific recognition protein 1XX
11513C1 domainXX
11515goat alpha-lactalbuminXX
11522the monomeric human M-ficolin fibrinogen-like domainXX
11523the second RRM domain of Nrd1XX
11524AF.2A1XX
11525PriC N-temrinal domainXX
11527PriB homodimerXX
11528METALLO-BASE-PAIRED DNAXX
11529a regulatory domain of meiosis inhibitorXX
11530chitin binding domain1XX
11535NavitoxinXX
11536MarkTX-7XX
11537actinomycinXX
11538TPI-LPSXX
11539PROTEINXX
11540esf3XX
11541Protein-RNA ComplexXXX
11542yeast Tim50 PBDXX
11543[G5,T7,S9]-oxytocinXX
11544ARMADILLO REPEAT PROTEIN SELF-ASSEMBLED COMPLEX (YIIM2-MAII)XX
11546sin1XX
11548MAXX
11549DnaTXX
11555the YAM domain of E. coli Transporter YajRXX
11556DHFR (G67V)-FolateXX
11561a' domain of Protein Disulfide Isomerase (oxidized form)XX
11562a' domain of Protein Disulfide Isomerase (reduced form)XX
11564RPEL motif of rat MKL1 proteinXX
1156594P-RPEL motif of rat MKL1 proteinXX
11566L105P-RPEL motif of rat MKL1XX
11567RPEL motif of rat MKL1 proteinXX
11568RPEL motif of rat MKL1 proteinXX
11569MIP-MDM2XX
11570SrtA AX bocLPATXX
11578complex between p53 transactivation domain 2 and TFIIH p62 PH domainXX
11580Fusion peptide in DPC micellesXX
11581Pre transmembrane domain in DPC micellesXX
11582Internal fusion peptide in DPC micellesXX
11583P2XHD monomerXX
11584c-Myb R2R3 C130IXX
11585c-Myb R2R3 V103L/C130IXX
11587Human Pin PPIase C113A mutantXX
11588Human Pin1 PPIase C113S mutantXX
11591chitosan-binding module 1XX
11592chitosan-binding module 2XX
11593RAMXX
11594The Acidic String of the Nucleotide Excision Repair Factor XPCXX
11595Zalpha domainXX
11596gallium ferredoxinXX
11599eIF1XX
11601hESRP1-RRM3XX
11607Reverse transcriptase recognition site of transcript of a LINE from Denio Renio, LS-1XX
11608DNA CONTAINING METALLO-BASE-PAIRXX
11609histone H2A-H2B heterodimerXX
12000CJP-4XX
12002second LysM domain from Volvox carteri chitinaseXX
12003neuronal SNARE complexXX
12010flagellar protein FliGcXX
12011flagellar protein FliGc A282TXX
12014TvCyP1 homodimerXX
12016Sup35NMXX
12018YAP-binding domain of transcription factor TEAD4XX
12019chitin-binding domain of chitinase A1XX
12020wild-type SPINK1XX
12021PPTIXX
12022sublancin 168 peptide moietyXX
12024cellulosomal double-dockerinXX
12026NZF domain in linear di-ubiquitin-bound formXX
12032NS1 effector domainXX
12033c-MYCXX
12040Rpn12 246XX
12041Q38FZ4XX
15002CtBP THAP domainXX
15003PinA WW domainXX
15007msp-1 c-terminal domainXX
15012Atu4866XX
15013SPCp41 monomerXX
15014hTraf6 2ZnXX
15016WW4 - peptide complexXX
15019DAGK homotrimerXX
15020exWIP-EVH1XX
15021homodimerXX
15023CarA(Nter)XX
15025sMTM7XX
15031alpha-conotoxin BuIAXX
15032FimFXX
15034YFED3 monomerXX
15035h6CarA(Nter)XX
15036beta-microseminoproteinXX
15037human beta-microseminoproteinXX
15038pfFKBP35FKBDXX
15039Chain 1XX
1504013-mer analogue of Prophenin-1 containing WWWXX
1504113-mer analogue of Prophenin-1 containing WWWXX
15042Tritrp5XX
15043noneXX
15044noneXX
15045BBP+EF in DHPC micellesXX
15046Subunit F of the A1AO ATP synthase from Methanosarcina mazei Go1XX
15047denatured ubiquitinXX
15049PCBP2 KH1+KH2XX
15050piscidinXX
15051Prophenin1XX
15055N-term of dnaAXX
15058En-6 monomerXX
15060monomeric DLC2 SAM domainXX
15061intein precursor polypeptideXX
15063ThTPase mouseXX
15068UA159XX
15069TCP3XX
15070heme oxygenaseXX
15071cdHOXX
15073cdHOXX
15074IBR domain of ParkinXX
150751-25MSP2XX
15076LC8 dimerXX
15077LC8 / Swa complexXX
15078LC8 / IC complexXX
15079ER382AXX
15080Yeast U2 stem IXX
15081Human U2 Stem IXX
15082Rat intestinal fatty acid binding proteinXX
15084CDA-BABP complexXX
15085RP4601 assemblyXX
15086hypothetical protein Cgl2762XX
15088ER411XX
15090str109 homodimerXX
15092single polypeptideXX
15094homo-trimerXX
15095Alpha-Syn12 bound with Synphilin-1XX
15098CHROMODOMAIN-HELICASE-DNA-BINDING PROTEIN 8XX
15100YfgJ with Zn+2XX
15101monomerXX
15102KCNE1XX
15109CPH domainXX
15110LymphotactinXX
15111Cbl-bXX
15112holo-c2sodXX
15113NC:muPsi complexXXX
15117NS1A:dsRNA complexXXX
15118YW12 monomerXX
15120MMP3 complexed with NNGHXX
15121UCH-L3XX
15122surfactinXX
15123NtailXX
15124Complex of VIR165 and FP1-23XX
15125monomerXX
15128RGS domain from human RGS14 proteinXX
15131MBPXX
15132Top7 monomerXX
15133Uncharacterized BCRXX
15134phl p 3XX
15139NirDXX
15140mytilinXX
15141TC-1 monomerXX
15142DL2A homodimerXX
15144SH3 monomerXX
15145neurotensinXX
15148HMGB1 AB boxes + basic tailXX
15149HMGB1 Full LengthXX
15153WW3-PPPPYPXX
15154protein-peptide complexXX
15157Duck HBV epsilon apical tetraloopXX
15158Bd37XX
15159phosphoit30XX
15160polymerase eta UBZ domainXX
15163LARG PDZ domain complexXX
15167YehRXX
15168LARG PDZ domainXX
15169monomerXX
15172H6TA0095XX
15176Darpp-32XX
15177CzrAXX
15178RGS3XX
15179Inhibitor-2XX
15180Spinophilin PP1 binding domainXX
15183CaM/CaMKKapXX
15184CaM/CaMK1pXX
15185CaM/eNOSpXX
15186CaM/smMLCKpXX
15187CaM/PDEsXX
15188calmodulinXX
15189CD5d1XX
15190HP0495XX
15191CaM-nNOSpXX
15192alphaC-Domain FragmentXX
15196NCp8-f2XX
15197CaBP1XX
15198all-Ala-hen egg white lysozymeXX
15200ApoORP monomerXX
15201denatured OmpXXX
15203CPE0013 monomerXX
15204huamn IgG1 CH3 domainXX
15206Needle MonomerXX
15207yajgXX
15208ChurchillXX
15209hDlg PDZ2/E6 complexXX
1521050s ribosomal protein l14eXX
15211protein yxeFXX
15212RRM1 domainXX
15213IntCB-DNA complexXXX
15214MxiHXX
15215XCL1/LymphotactinXX
15217YKVR MonomerXX
15218ATWLPPR heptapeptideXX
15219RXRalpha LBD ternary complexXX
15223AB G alphaXX
15224AB G betaXX
15225Domain 2 of Non-structural Protein 5A (NS5AD2)XX
15228duplex DNA containing an abasic site with opposite T (beta anomer)XX
15230RalB-GMPPNPXX
15232v8pfXX
15238Ab C alphaXX
15239Ab C betaXX
15240ERCC1 centralXX
15242a single polypeptide chainXX
15243TCTP monomerXX
15245villin G34L monomerXX
15247POTRAXX
15248Subtilisin bound to prodomainR9XX
15249Cyclic Nucleotide Binding Domain (CNBD) in Complex with cAMPXX
15250SubtilisinXX
15252UvsW.1XX
15253dihydrofolate reductase with folate boundXX
15254PrSH3XX
15255SH3XX
15256ApolPBPXX
15257RsmE dimer with two RNA stem loopsXXX
15258VP2129XX
15259lcnGaXX
15261lcnGbXX
15264ahpfnXX
15265Orf c02003 proteinXX
15267PW2 in DPC micellesXX
15268ApoCIIIXX
15269ATC2521XX
15270RP3097XX
15271SMB domain from vitronectinXX
15272M cono-toxin mr12XX
15273conopeptide mr12 mutantXX
15275srp54 of archaeoglobus fulgiusXX
152766aJL2XX
15281CcR55XX
15282N-Me-Phe5XX
15284N-Me-Leu8XX
15285N-Me-Lys11XX
15286BungatoxinXX
15287N-Me-Phe12XX
15288YobA 21-120XX
15289THAP domainXX
15291N-Me-Gly13XX
15292N-Me-Ser14XX
15293N-Me-Leu8/N-Me-Ser14XX
15294N-Me-Val1/N-Me-Leu8/N-Me-Ser14XX
15295At3g28950.1XX
15298beta-synucleinXX
15300THAP domainXX
15301CcV28C AdxL80CXX
15302OdorranaXX
15303bb-PDI monomerXX
15304ExbD periplasmic domainXX
15305cardiotoxin A3XX
15309cardiotoxin A5XX
15315DDR2-DSXX
15316GCN4XX
15317CPS 2611XX
15318PelovaterinXX
15320UPF0350 protein VC 2471XX
15322monomerXX
15323moricinXX
15324RPA2121 doamin-swapped dimerXX
15325CTDXX
15327YqcCXX
15329hr387XX
15333Pirh2 RING domainXX
15335SyR11XX
15336single polypeptide chainXX
15337SO0334XX
15338YfgJ monomerXX
15339Ribosome Modulation FactorXX
15340CFTR Regulatory RegionXX
15341full length SiR90XX
15343HR4730AXX
15344RhR5XX
15346YejL homodimerXX
15347NE0084XX
15348JARID1CXX
15349Nck1-2 SH3XX
15350sr478 dimerXX
15351Nck1-1 SH3XX
15352rpt8 dimerXX
15353BoR54XX
15354NMR Structure of protein Q60C73 METCAXX
15356HR2869AXX
15357SNase complexXX
15359arenicin monomerXX
15361mmp-20XX
15363mr12XX
15364NCp8XX
15369ribosome-inactivating proteins (RIP)XX
15370apd monomerXX
15371antimicrobial resistance proteinXX
15372TCI monomerXX
15373Ros87XX
15378VraRXX
15379Sup35 NM domainXX
15381NapDXX
15383ClpC N-domainXX
153844HB homodimerXX
15385F104W cTnCXX
15386str82XX
15388F153W cTnCXX
15390HA Fusion Domain Mutant F9AXX
15391KIA7 peptide tetramerXX
15392KIA7F peptide tetramerXX
15400F153(FTR) cTnCXX
15404CBP homodimerXX
15405RGD-hirudinXX
15406PapIXX
15407CD2AP SH3-C monomerXX
15408delta1.5XX
15411Single polypeptide chainXX
15413YW12DXX
15415monomerXX
15419RPA3401XX
15422KChIP4a monomerXX
15423a single polypeptide chainXX
15425KChIP4a(Delta1-42)XX
15427F104(FTR) cTnCXX
15429LFABP-apoXX
15430PDEgammaXX
15433holoLFABPXX
15434cpxLFABPXX
15437S836 monomerXX
15439FFXX
15440HasBXX
15441IC74XX
15444DNA binding domain of NgTRF1 monomerXX
1544515.5KXX
15449ACP domain from ratXX
15450ThrA3-DKP-insulinXX
15451OST domain in GABP alphaXX
15452profilin IIXX
15454ALOA3-DKP-insulinXX
15455AbaA3-DKP-insulinXX
15456dimerXX
154571655-1822XX
15458F0XX
15460AK12XX
15461ccc2XX
15462HI0947 HomodimerXX
15464Human Insulin MonomerXX
15465Ph1500NXX
15466PinA WW domainXX
15469nsp3(513-651)XX
15470Calmodulin-Munc13-1XX
15471Peptidyl-tRNA hydrolase domain proteinXX
15473dSUMOXX
15474Unfolded apoflavodoxinXX
15476SR384-1-46XX
15477Prod1XX
15478M7XX
15479CD4mutXX
15481HOMER3A EVH1 domainXX
15482rhr95XX
15483SQAPIXX
15489paenibacillinXX
15490NusGXX
15491VfR117XX
15492willardiine-S1S2XX
15493fluorowillardiine-S1S2XX
15494bromowillardiine-S1S2XX
15495iodowillardiine-S1S2XX
15496kainate-S1S2XX
15497MxiDXX
15498UbcH7XX
15499ZF:ZNXX
15500ZF-C417F:ZNXX
15502HMGB1XX
15503MxiM(28-142)XX
15504MxiM - MxiD complexXX
15506Colicin N T domainXX
15507Mip-rapamycin complexXX
15510Nckalpha-SH3.1XX
15511C-terminal dimerization domain of SARS coronavirus nucleocapsid proteinXX
15512Palladin Ig3 domainXX
15513VpU polypeptideXX
15514human IgG1 FcXX
15515daptomycin in DHPCXX
15518GW1929-PPARgamma Ligand-Binding Domain ComplexXX
15519opnXX
15522pUL89(580-600)XX
15524RLIP76XX
15525RLIP76XX
15528ePABP2-trpXX
15529sr360XX
15530apo-Mj0056XX
15531rhGM-CSFXX
15532wt1-17merXX
15533wt1-zf14-14merXXX
15534c-Cbl UBAXX
15535Ga88XX
15536EnHDXX
15537Gb88XX
15539DUF683 tetramerXX
15540C-terminal chromo domainXX
15542yajIXX
15543rna bound nelfe-rrmXXX
15544YW12D SDSXX
15545FLN29+4ZnXX
15546DsbB-ubiquinoneXX
15547GlUb(S27a)XX
15548stefin BXX
15549c6orf115XX
15550hPCIF1 WW domain monomerXX
15551Dok1XX
15552beta3 integrinXX
15553Gal lectinXX
15557ADF monomerXX
15558fat globule-EGF-factor 8-LXX
15560RecA miniInteinXX
15561DREAMXX
15562Ymr074cp (1-116) monomerXX
15563USRCXX
15567PDZ domainXX
15568NeR45AXX
15569PAH1XX
15570PAH1-Sap25XX
15573Protein LXXX
15576NFATC2IP Ubh monomerXX
15578MMP12 HUMANXX
15579NS2XX
15580NS4AXX
15582NS3XX
15583RG16XX
15584STR220XX
15585ATU1810XX
15587ubiquitin-related modifierXX
15589Sperm Whale apoMb(1-77) complex with DnaK-betaXX
15591P62 UBAXX
15592P62 UBA in complex with ubiquitinXX
15593C6orf130XX
15594calbindin with Yb3+XX
15595yst0336XX
15596Human macrophage inflammatory protein 3alphaXX
15602domain C of human PARP-1XX
15603LIPOPROTEIN SPRXX
15604SgR42 proteinXX
15605mperXX
15607At3g16450XX
15608VPA0419XX
15610BH09830XX
15611ewr120 proteinXX
15612Inner-linker peptide from PDHXX
15614complexXX
15615F0F1XX
15616F1XX
15617alg13XX
15618nsp3(527-651)XX
15620single polypeptide chainXX
15621single polypeptide chainXX
15622antilipopolysaccharide factorXX
15623CaBP1XX
15624CaMCaNpXX
15625VBS3XX
15626yeast ARF1 monomerXX
15629complex pyoverdine PvdI-Ga(III)XX
15632TCS C-domainXX
15633CXCL12/SDF1-alphaXX
15634FeoC monomerXX
15635CXCL12/SDF1-alpha, CXCR4XX
15636CXCL12/SDF1-alpha, CXCR4XX
15637CXCL12/SDF1-alpha, CXCR4XX
15638Rv1567c monomerXX
15639monomerXX
15640monomerpXX
15642NusGXX
15645Im7 mutantXX
15651KpOmpA transmembrane domainXX
15652RrR43XX
15653Vinculin TailXX
15654Insulin-like growth factor-I (IGF-I)XX
15656Duck HBV apical loopXX
15661hp1203XX
15662amelogeninXX
15663CaBP3 monomerXX
15666Im7 mutantXX
15667PeptideXX
15669PH domain of GRP1XX
15672p12CAN monomerXX
15673PisIXX
15674chromobox protein homolog 7XX
15676prion proteinXX
15677water-soluble analogue of KcsAXX
15678SeR13XX
15680Phosphatase domain of PTPN7XX
15683YiaDXX
15684lipocalinXX
15687TA0895XX
15688TA0956XX
15689UBBXX
15690protein complex MNK1-Cu(I)-HAH1XX
15691RelBXX
15693Pax8 paired Box DomainXX
15695chromobox protein homolog 4XX
15698Lethocerus F1 troponin C isoformXX
15700human N-termal doamin of pirh2XX
15701human C-termal doamin of pirh2XX
15702BP2786XX
15703CD69XX
15705Galectin-3-LBTXX
15706DFP inhibited mature subtilisin EXX
15707split PH domain from Phospholipase C gamma 2XX
15716AlgE6R1XX
15718myoferlinXX
15719calponin monomerXX
15720Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein familyXX
15721ATU1203XX
15722Ca2+ bound Collagen binding domain derived from Clostridium HistolyticumXX
15724Flavodoxin oxidizedXX
15725Flavodoxin oxidizedXX
15726La NTD apoXX
15727La NTD complexed with 5'UUUUXXX
15728EphA1 TM dimerXX
15729Tick Carboxypeptidase InhibitorXX
15730intermediate IIIa of Tick Carboxypeptidase InhibitorXX
15731Tick Carboxypeptidase InhibitorXX
15733chicken Lamin B ReceptorXX
15735AcrAXX
15736Full-length Human frataxin monomerXX
15737AcrA(61-210DD) glycosylatedXXX
15738HP1442XX
15739hydramacin-1XX
15740protein K7 from the Vaccinia virusXX
15743HahellinXX
15744Lipid-free human apolipoprotein EXX
15746BPP3783 115-120XX
15747TMIX peptideXX
15748D,L-Peptide FoldamersXX
15749D,L-Peptide FoldamersXX
15750Lin0334XX
15752ILTat1.24 C2 domainXX
15753ILTat1.24 C1 domainXX
157562-3F1XX
15757monomerXX
157584-5F1XX
157593F3XX
15761JHP0511XX
15762SfR90XX
15763Human Mia40XX
15765Tetraheme Cytochrome from Shewanella FrigidimarinaXX
15766hCSD1XX
15767HCV-C82 monomerXX
15768HCV-C82 monomerXX
15770CarS1XX
15773Human ProlactinXX
15774Rv1761cXX
15775The transmembrane C-terminal domain of the Amyloid Precursor ProteinXX
15778CHIPS-C5aR(P7-28S)XX
15782DEN1ED3XX
15783FGF-1XX
15784NikA(1-51) homodimerXX
15785C2AXX
15786edhbvXX
15787HINT1XX
15788Ferredoxin-NADP ReductaseXX
15789Ca-bound MCFD2XX
15790ANDES HANTAVIRUS NUCLEOCAPSID PROTEINXX
15791SoR190XX
15796E2-c-CblXX
15797monomerXX
15798Tpx monomerXX
15799HIV-1 Gag p6ctXX
15803RalB-RLIP complexXX
15804TR8 proteinXX
15805PA0246XX
15807gpVXX
15808alpha-Actinin4 CH2 domainXX
15809myr-yARF1.GDP, monomerXX
15810PA1076XX
15811S27AXX
15812FeoA-like proteinXX
15814Domain 5 of Dictyostelium ABP-120XX
15816DsrRXX
15817HPLC-12XX
15819TR91AXX
15820RRM1 of hnRNPLLXX
15821MJ1198XX
15822A3DK08 PROTEINXX
15823Atu0742XX
15824Prion ProteinXX
15825PsR76AXX
15827MSI-594XX
15828PF0385XX
15829SaR32XX
15833GsR195XX
15834FeoA proteinXX
15835BpR195XX
15836tt824aXX
15837IRON(II) TRANSPORT PROTEIN AXX
15839yiiFXX
15840RhR2XX
15841Protein FeoAXX
15843ECA1580XX
15844GmR137XX
15845Prion ProteinXX
15846Q812L6 PROTEINXX
15847XF2673XX
15848YhhK CoAXX
15849MrR110BXX
15850BcR103AXX
15851Stromal interaction molecule 1XX
15853KcsAXX
1585629-MERXX
1585729-MERXX
1585829-MERXX
1585929-MERXX
158605'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'XX
15863EAS D15XX
15864pdcd5XX
15865DARPP-32XX
15866CIN85 Sh3-C domain/ubiquitin complexXX
15867GED monomerXX
15868GED monomerXX
15870H1-47 subunit A ATP synthaseXX
15875Nudix hydrolaseXX
15876LL-37XX
15877LC3/p62 complexXX
15881PSAXX
15882SPF45 UHM domainXX
15883CTL9XX
15884CTL9XX
15885UHM domain of Puf60XX
15887minimal complex of Puf60 and U2AF65XX
15888minimal complex of Puf60 and SF1XX
15889minimal complex of Puf60 and SF1XX
15890minimal complex of Puf60 and SF3b155(317-357)XX
15891minimal complex of Puf60 and Prp16(201-238)XX
15899C-terminal CH domain of alpha-parvin monomerXX
15901D+PHSXX
15902Ta0387XX
15903Rv0008c monomerXX
15904Flavodoxin oxidizedXX
15905Ribonuclease T1XX
15906FrataxinXX
15907UbiquitinXX
15908XylanaseXX
15909DiisopropylfluorophosphataseXX
15911MalF-P2XX
15912Itk SH3 and Itk SH2 domainsXX
15913IsdCXX
15914Binder of Arl2XX
15916ATU0232XX
15917blaKRXX
15918M-crystallinXX
15919RAP74/FCP1 complexXX
15922PPIL1/SKIPXX
15923rat S100BXX
15927StnIXX
15928ARNT PAS-B Slipped IB StrandXX
159304 sigma70XX
15933NOGOXX
15934M-crystallin in 6M Gdn-HClXX
15935Pfu RPP29d17-RPP21V14 complexXX
159364 sigma70XX
15939FOXO3aXX
15940Saccharomyces cerevisiae V(1)V(O) ATPaseXX
15942RRM2 monomerXX
15943yegPXX
15945MDM2 N-terminal domain, residues 17-125XX
15948RING Finger monomerXX
15949PRL-1 C170-171S monomerXX
15950E.Coli SlyDXX
15951p7XX
15953H55K mutant of LC8XX
15954eIF5AXX
15955PRXX
15958Shq1pXX
15959Phosphotyrosine-Binding Domain of Insulin Receptor Substrate-1 MonomerXX
15962HasAp truncated polypeptideXX
15963HasAp Full-Length polypeptideXX
15964ERp18XX
15965TM1b(1-19)Zip/TM9d252-284 complexXX
15966DsbBXX
15967IscU-HscB complexXX
15972Mast205 monomerXX
15974b-b'-xXX
159754 sigma70XX
15977CdnLCXX
15978Fowlicidin-1XX
15979Fowlicidin-1XX
15980Fowlicidin-1XX
15981Cgi121XX
1598689FnI-collagen complexXX
15987ORF56XX
15988TonB2-CTDXX
15989Myb1XX
15990RNAP monomerXX
15991Core Binding DomainXX
15992Vm24XX
15998b'-xXX
15999HTH 3XX
16003BASP1XX
16005EphA2 TM dimerXX
16006TM1112XX
16007TM1367XX
16008SUD-CXX
16009NpuDnaE inteinXX
16010bovine pancreas ribonuclease AXX
16011bovine pancreas ribonuclease AXX
16014TAZ1/STAT2 complexXX
16015TAZ2/STAT1 complexXX
16016TM0212XX
16018HtAXX
16020M2 Transmembrane PeptideXX
16022KIA7W tetramerXX
16023KIA7H tetramerXX
16026INSULIN A CHAIN, INSULIN B CHAINXX
16027INSULIN A CHAIN, INSULIN B CHAINXX
16029At2g32350XX
16030BPP2914XX
16031Nav1.5XX
16032NaV1.2 C-terminal EF-hand domainXX
16035BamCXX
16037BlrP1 BLUFXX
16038pOdhIXX
16039OdhIXX
16040onconase C87A/C104AXX
16042hb-FABPXX
16044PyLTNTXX
16046DHA-hb-FABPXX
16047ELA-hb-FABPXX
16048OLA-hb-FABPXX
16049EIC-hb-FABPXX
16051MM0293XX
16052STAS domain of Rv1739c, a putative sulfate transporter of Mycobacterium tuberculosisXX
16053PROTEINXX
160545'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'XX
160555'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'XX
16056TMXIXX
16060NTII-nAChRXX
16061HybEXX
16062En-1XX
16064BF1650XX
16065RelE:RelBc complexXX
16066RelEXX
16067RelBcXX
16070Pin1 WWXX
16071mPrP90XX
16072SSP0047XX
16075mPrP90XX
16076mPrP90XX
16077mPrP90 P105LXX
16078mPrP90 A117VXX
16079mPrP90 3AVXX
16080mPrP90 3AVXX
16083MrR121AXX
16084SRU 0103XX
16085ACP single polypeptide chainXX
16088Pin1 WWXX
16089sso0164XX
16091rps8XX
16093SRU 2040XX
16096DvR115GXX
16097CtR107XX
16098Apo-form YjaBXX
16099FSTL-3XX
16100DR A0006XX
16101AR3445AXX
16102BcR268FXX
16103FAIM-CTD monomerXX
16104AMYLINXX
16105AmylinXX
16108single polypeptideXX
16109Herpud2 9 85XX
16110BorealinXX
16111Art v 1- the major allergen of Artemisia vulgarisXX
16112HsapBK(233-260)XX
16113yppeXX
16115p80-CoilinXX
16116Ga95XX
16117Gb95XX
16118PFE0790cXX
16120Atg8XX
16121L14e ribosomal proteinXX
16122HCV NS4B(227-254)XX
16124RppHXX
16127SAP30 ZnFXX
16130Tdom 40-76 TolAIII complexXX
16131Tdom40-76XX
16133TolAIIIXX
16134TolAIII+tdomXX
16136jerdostatin polypeptideXX
16137AIDA1XX
1613834-MER, SILVER IONXX
16139caskinSH3XX
16140MonomerXX
16141HACS1 SH3 domainXX
16142CXCL12/SDF1-alphaXX
16143CXCL12/SDF1-alphaXX
16144Bp-OhrXX
16146SEHXX
16147TrxXX
16148PlnKXX
16149PlnKXX
16150jerdostatin R24KXX
16151jerdostatin -N45G46 polypeptideXX
16152jerdostatin R24K -N45G46 polypeptideXX
16153SvtR08XX
16154MM0293XX
16155HS00059XX
16158beta1D integrin tailXX
16159beta1A integrin tailXX
16160MYPT1 1-98 monomerXX
16161BfR257CXX
16162beta1D integrin tailXX
16163F0XX
16167FXYD4 monomer in micellesXX
16168PHOSPHOLEMMANXX
16169BarnaseXX
16170BarnaseXX
16171BarnaseXX
16172barnaseXX
16173p23tXX
16174Rv0287-Rv0288 complexXX
16175CquiOBP1XX
16176Prp40-FF4XX
16177E73 HomodimerXX
16183Tammar Wallaby Prion Protein (121-230)XX
16184Mouse Prion Protein (121-231)XX
16185Mouse Prion Protein (121-231)XX
16186PSPTO 3016XX
16188Rv2175cXX
16189FKBP3-NXX
16190cNTnC and WW7XX
16191MonomerXX
16195AKAP13-PHXX
16209JARID1A PHD finger 3XX
16210JARID1A PHD finger 3XX
16211PpiDXX
162125'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'XX
16214Zn finger protein YBILXX
16215wt-brazzeinXX
16216ITSN1XX
16217apoMb(1-119) fragment in the presence of DnaK-betaXX
16218apoMb(1-119) fragmentXX
16219PTK6-SH3XX
16221CBD monomer of MMP2XX
16228ubiquitinXX
162291H, 13C, and 15N Chemical Shift Assignments for ring1B C terminal domain/ cbx7 CBOX complexXX
16230U6 snRNP (small fragment)XXX
16231Pathogen Recognition Domain from Plodia interpunctellaXX
16234MPMV NTD CAXX
16236Bruno RRM3+XX
16237OmpATbXX
16238VC A0919XX
16239Plantaricin JXX
16240SlyDXX
16241Plantaricin JXX
16243Prp24-RRM23XX
16244U6 snRNP (fragment)XXX
16246Prp24-RRM2XX
16247F1Fo ATP synthaseXX
16248PknB-phosphorylated Rv1827XX
16249NR3 dimerXX
16250human intersectin-1XX
16251syr103b proteinXX
16252A13XX
16253Rv2377cXX
16256DroshaXX
16257Nogo66 in pH 4.0XX
16258RCLXX
16259beta7 integrin tailXX
16260PvFKBDXX
16261MicroplusinXX
16262p68NXX
16263NLRP7 Pyd monomerXX
16265N-terminal domain monomerXX
16267tungsten formylmethanofuran dehydrogenase subunit DXX
16268cannabinoid receptor-2 helix 6XX
16269n-NafYXX
16270Sortase A-substrate complexXX
16271OCRL bridges clathrin-mediated membraneXX
16272VpR247XX
16273OCRL bridges clathrin-mediated membraneXX
16274SLBPXX
16276SO2144XX
16278SO2144XX
16279Hsp90 middle domainXX
16280d(GAGCTC)2XX
162811:1 complexXX
16283VpR247XX
162872:1 complexXX
162881:2 complexXX
162901:1 complexXX
162912:1 complexXX
162922:1 complexXX
16293CA150 FF1+linkerXX
16297AIDA-1 SAM domain tandemXX
16298SH1003XX
16299T1 domain tetramerXX
16306Truncated hemoglobinXX
16307Truncated hemoglobinXX
16311VEK-30/plasminogen kringle 2 complexXX
16312mul A0064NXX
16313AR3436AXX
16315putative phage integrase IntSXX
16316IntB phage-integrase-like proteinXX
16317human interleukin-33XX
16318CBP TAZ2/Adenoviral E1A ComplexXX
16319Carnocyclin AXX
16320SSO6904XX
16321UbcH8XX
16323SLBP30merXX
16325lkr136bXX
16329DsbA monomerXX
16330DsbA monomerXX
16334nonmyristoylated NCS1XX
16335BSU15050XX
16336NMB1076XX
16337Complex of APH with antibiotic tobramycinXX
16338CG11242XX
16340calcium-loaded Calbindin D9K P43GXX
16342a-synucleinXX
16343INSULIN A CHAIN, INSULIN B CHAINXX
16344S6wtXX
16345permutant P54-55XX
16347ATC0852XX
16348DEAD RINGER-LIKE PROTEIN 1XX
16349Tyrosine-protein kinase ABL2XX
16350pheromone En-A1XX
16352AF2094XX
16353Proto-oncogene tyrosine-protein kinase FERXX
16354A1AO ATP synthaseXX
16355AR3449AXX
163565'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'XX
16357TR5XX
16359NS2B NS3proXX
16360S100A1 (aa) dimerXX
16361p62 PB1XX
16362monomerXX
16363CBPXX
16364Mb1858XX
16365YOR252WXX
16366TM1076XX
16367CFTR NBD1-RE monomerXX
16368Mb0332XX
16370Human MyotilinXX
16371DSY2949XX
16373SPA4288XX
16374NleG2-3XX
16375NleG2-3XX
16376OR8w187rXX
16377RPA3574XX
16378GtR34CXX
16380gi-13879369XX
16381VDAC-1XX
16382Alr3790XX
16384SR232XX
16385PF1109XX
16386Human Fibulin-4XX
16387OR15XX
16388NsR431CXX
16390ubiquilin 1XX
16392TEM-1XX
16393CFTR NBD1-RE monomerXX
16394deltaF508 CFTR NBD1-RE monomerXX
16395M.HhaI-DNA-cofactor ternary complexXX
16396CBDXX
16397human ataxin-7XX
16398Psb27XX
16399W4W9 MonomerXX
16402human Ataxin-7-L3XX
16407W2W11 MonomerXX
16411Rtt103 CTD interacting domainXX
16412Rtt103 bound to CTD peptideXX
16413C17orf37XX
16414TnC-TnIXX
16415ns-LTP-DMPG complexXX
16416HIV-PR(D25N)-substrate C complexXX
16417AfaE-dsc DAF1234 complexXX
16418apoCaM-IQ peptideXX
16419ACBP-palmitoyl-CoAXX
16420Fyn SH3 GuHCl complexXX
16421Chagasin/cruzipain complexXX
16422C16PN/NRho complexXX
16423protein:ligand complexXX
16424BamEXX
16426murine Ets-1XX
16439factor H (modules 10-15)XX
16442At3g03773.1XX
16443cytochrome c3XX
16444SC35XX
16445K2XX
16446monomerXX
16450YSK2XX
16453LMW-PTP DimerXX
16454CR3/RBDXX
16455Gall5Glc/Peptide 2XX
16456TRAP-TSR/heparinXX
16457CBM2b/cellohexaoseXX
16458cL-BABP GCDA complexXX
16459Ran BD2/Ran C complexXX
16460MutS nucleotide complexXX
16461VPR dimerXX
16462Sem-5 Sos peptide complexXX
16465CaM-peptideXX
16467AML1-ETO/HEB peptide complexXX
16468PcTx1XX
16469Ribonuclease T1XX
16470ShcA PTB domain-NPLH peptideXX
16471IQGAP1 (401-533)XX
16472TENC1XX
16473Rv3250cXX
16475LpxC-L-161,240 complexXX
16476ATC0905XX
16477e1 peptideXX
16478UBAXX
16480LDLRXX
16481pfLamA (50% Ca2+)XX
16482LRP-1XX
16483CR17 from LRP-1 and ApoEXX
16485THAP RRM1XXX
16486GTP pyrophosphokinaseXX
16492Anti-TRAPXX
16498CLOLEP 01837XX
16503RNase AXX
16504Human cannabinoid receptor 1 - helix 7/8 peptideXX
16505octarepeatsXX
16507MmPar3 PDZ3, MmVE-CadherinXX
16508synaptobrevinXX
16509CR1618XX
16510first PHD finger/non-modified histone H3 tail complexXX
16511hDpl(122-139)D124NXX
16512syb60-116XX
16514syb96XX
16515mPar3 PDZ2XX
16516APE1 (39-318)XX
16517BR7XX
16518Tc GPXI monomerXX
16519SDF1a H25RXX
16520hPar3 PDZ2XX
16521CV 2116XX
16522hDpl(122-139)XX
16523pfColA monomerXX
16536Wilson Disease Associated ProteinXX
16538Pdcd4 MA-3MXX
16539nasonin-1XX
16540nasonin-1MXX
16541Nurr1 monomerXX
16542Pdcd4 MA-3 M-CXX
16549Mus81 NTDXX
16550ARNO(375-400)XX
16551ARNO-pXX
16555CA-CTD dimerXX
16556SCO3027XX
16557ErR9AXX
16558MAGI-1 PDZ1XX
16559MAGI-1 PDZ1 / E6CTXX
16560protein from gene locus NE0665XX
16561BcR147AXX
16562ROSSMANN 2x2 FOLD PROTEINXX
16563Lin0431XX
16564Atu1219XX
16568DhR29aXX
16569cgr26aXX
16570YbbR family protein Dhaf 0833XX
16571ML4XX
16572Lamin-B1XX
16574NEDD4 3RD WW DOMAIN/HUMAN T-CELL LEUKEMIA VIRUS complexXX
16575NEDD4 3RD WW/ILPTAPPEYMEA complexXX
16576Protein BH0266 From Bacillus haloduransXX
16577Homeodomain DNA complexXXX
16578DSY1790XX
16579Flavodoxin oxidizedXX
16580Ribonuclease T1XX
16581FrataxinXX
16582UbiquitinXX
16583XylanaseXX
16584DiisopropylfluorophosphataseXX
16585SNase140XX
165863F5 VHHXX
16587W60G beta2-microglobulinXX
16588Aha1 monomerXX
16589PthAXX
16590EF-hand domain of polycystin-2XX
16591LAIR-1XX
16592BT9727 4915XX
16593F98N-fdxXX
16594atc0888XX
16598cTEM-17mXX
16599clytin monomerXX
16600cgGFPXX
16601HCV Core-E1 signal peptideXX
16602KCNE3XX
16603IscUXX
16606kI O18/O8 Y87HXX
16607AL-09 H87YXX
16608ProinsulinXX
16610AsnRSXX
16611SUMO-1 Daxx SIM complexXX
16612M2-TM amtXX
16613SUD-MCXX
16615HU-beta2XX
16617ATHXX
16618J-domain of CbpAXX
16620hs00184XX
16621KCNE3XX
16622SH3 monomerXX
16624acyl carrier protein from a fungal type I polyketide synthaseXX
16626UbiquitinXX
16627Protein GB1XX
16628MloK1 CNBD monomerXX
16630stnIIY111NXX
16632KalirinXX
16634ddIhh-V67CMXX
16636ComACXX
16638NHERF1 (150-358)XX
16639V of beta2-glycoprotein I and ligand-binding module complexXX
16641CD2AP SH3-A monomerXX
16642CD2AP SH3-B monomerXX
16643CD2AP SH3-C monomerXX
16646RBD1,2 domains from human nucleolinXX
16647CPF 0587XX
16648UuR17AXX
16652asl3597XX
16656Q251Q8 DESHYXX
16657Sic1XX
16658B1B2XX
16659pSic1XX
16660Substance P-NK1 complexXX
16661TP-ACPXX
16662AeSCP-2XX
16663HUMAN INSULIN MUTANTXX
16665AeSCP-2-PAXX
16666Sd5XX
16668RhoA-GDP monomerXX
16669RhoA GTPgS monomerXX
16670NALP1 PYDXX
16672transmembrane domain of the n-acetylcholine receptor beta2 subunitXX
16673BS3XX
16674cytochrome c3XX
16675protein-glutaminaseXX
16678Sensory Rhodopsin IIXX
16680NanogXX
16681HR5531EXX
16683REF2-I/HSV-1 ICP27 peptideXX
16686lmo0835XX
16687ilvNXX
16688CPE1231XX
16689PshDsbAXX
16690C. albicans Ess1 prolyl isomeraseXX
16691SgR46XX
16692BvR106AXX
16696ICP27XX
16697REF2-IXX
16698ORF57XX
16703SPI2XX
16704SPI2 (T7Y)XX
16705SPI2 (T7A)XX
16708BRUNOL-3XX
16710spider rollXX
16711NP 415897.1XX
16715Vaccinia Related-Kinase 1XX
16721BRD1 PHD1 fingerXX
16726myristoylated NCS1XX
16727culbertcidinXX
16729SipDND38XX
16731putative disulphide-isomeraseXX
16732PknB PASTA12XX
16733PknB PASTA23XX
16734PknB PASTA34XX
16735Anthrax Lethal Factor C-terminalXX
16736P62 PB1 DimerXX
16737NMB1343XX
16738VRK1XX
16739plectasinXX
16742Ribonuclease AXX
16743HuPrP(90-231 M129 Q212P)XX
16744APLFXX
16746GmR58AXX
16750c-src SH3XX
16751HSA salicylate complexXX
16752Troponins T and CXX
16753P450cam Pdx complexXX
16754RPA70A Rad51N complexXX
16755N40 C16 complexXX
16756Abl/Crk/Crk pY221 complexXX
16757PrP/copper complexXX
16758calbindin/CA complexXX
16759cytochrome c/phosphate complexXX
16760FPA/Gly-Pro-Arg-Pro complexXX
16761ATP7B N-domain/ATP complexXX
16762PP4R2/Calsensin complexXX
16763VHS/ubiquitin complexXX
16764CALMODULINXX
16766BLM HRDC domainXX
16767Reg IVXX
16770PrgI mutantXX
16772CI-MPR domain5XX
16773CI-MPR domain5XX
16774Rv0543cXX
16777hahellinXX
16778CBX7/H3K27me2 complexXX
16779Lmo2-LIM2/Ldb1-LIDXX
16780CobRXX
16781dynein microtubule binding domainXX
16782Photosystem II reaction center Psb28 proteinXX
16783Smr dimerXX
16784conotoxin mr3cXX
16785conotoxin cis-mr3cXX
16786cis-conomarphinXX
16787Thermus thermophilus Rieske protein (cofactor bound)XX
16788NusG:NusEXX
16790CV0863XX
16791yaiAXX
16792SAP domain of MKL/myocardin-like protein 1XX
16794ZR215XX
16795KpR49XX
16797mTZD finger2XX
16801lmo0835XX
16802CcmHXX
16803RanE66S dimerXX
16804Thermus thermophilus Rieske protein (cofactor bound)XX
16805RpR324XX
16806SgR145XX
16807DhR1AXX
16808HR3057HXX
16809Itk SH3 and Itk SH2 domainsXX
16810PgR37AXX
16811SrtAXX
16812MED1:DNA complexXXX
16813complex of Ubl and SH3XX
16814mTZD finger1XX
16815mTZD finger3XX
16816HR4547EXX
16817dermcidin-1LXX
16820S8EXX
16821SRU 0103XX
16824WASP/EspFU complexXX
16831C-domain of Lsr2XX
16833WR73XX
168345'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'XX
16835Atg8XX
16838soluble tissue factorXX
16841Fibronectin 6FnI1-2FnII7FnIXX
16842PpcAXX
16845cementoinXX
16847LC8 bound to residues 233-249 of neuronal Nitric Oxide SynthaseXX
16848PFUCXX
16849rubredoxinXX
16851KIX ETAD1XX
16853CD4mutXX
16854eye lens fragmentXX
16856acyl carrier proteinXX
16857Exon 6 of human Jagged-1XX
16860holo acyl carrier proteinXX
16862CaBP1XX
16863KipI-NXX
16864uvi31+XX
16868NusAXX
16870Human Tubulin Cofactor CXX
16871ZO-1 PDZ2XX
16876ERD14XX
16879PDZ3 PTP-BLXX
16880UBM2 in Complex with UbiquitinXX
16881polyketide cyclase SCO5315XX
16882Ubiquitin-Binding MotifXX
16883H-REV107NXX
16884RRM3 monomerXX
16885UBM1-Ubiquitin complexXX
16886HCV NS2 [27-59]XX
16891alpha haemoglobin in monomer-dimer equilibriumXX
16892NS2[60-99]XX
16893MDM4 N-terminal domainXX
16894MDM4-nutlin3 complexXX
16895UBB+1 (ubiquitin B mutant)XX
16897MTH1821XX
16898alpha-haemoglobin:AHSP protein complexXX
16899UBL domain of UBLCP1, I5MXX
16900MDM4-p53 complexXX
16901Human Relaxin-like FactorXX
16904alpha-synucleinXX
16905Sma0114, response regulatorXX
16907HAfpXX
16908Ubiquitin like domain of UBLCP1XX
16910Prestin STAS monomerXX
16911VARC244XX
16915Human Insulin Mutant A22Gly-B31Lys-B32ArgXX
16916spMDD complex with ligandsXX
16919spMDDXX
16921MinE dimerXX
16926E. coli lipoproteinXX
16928hERG N-terminal domainXX
16929TerD-CA2+XX
16930F2XX
16932F2F3XX
16934PBS domainXX
16935PECAM-1XX
16942SR518XX
16944CpR82GXX
16945chicken parvalbumin 3XX
16946hERG1-135XX
16948GTPase Effector Domain ( GED)XX
16949PDZ3 of ZO-1XX
16954NHR3/PKA(RIIa) ComplexXX
16955calcium-bound CPV3XX
16957KvAPXX
16959F1F2XX
16961Dsy0195(21-82) proteinXX
16962ERp18XX
16963U1-Liotoxin-Lw1aXX
16964HET-s(1-227)XX
16965HET-s(1-227)XX
16967MAST2-PDZ/PTEN-C TerminusXX
16968Derivative of HRFXX
16970Bem1p SH3-CI domain with Ste20pXX
16971TraI 381-569XX
16977nsp7aXX
16978CKR-brazzeinXX
16979ec0544XX
169805'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'XX
16981SARS Coronavirus Nonstructural Protein Nsp7XX
16982D-allose binding proteinXX
16983PHD3 finger of MLLXX
16984ALBPXX
16988PtR41OXX
16989CYP33XX
16991NeR70AXX
16992RKIPXX
16994C-Terminus Calmodulin F92EXX
16995bolA protein (ECH 0303)XX
16996human Rad51D NXX
16997SF1141XX
16998HR4653BXX
16999CV0426XX
17000E1-69 of Yeast V-ATPaseXX
17002YP 510488.1XX
17003N-terminal Vpr peptidesXX
17005trPRAIXX
17006Atg19XX
17007Alpha-mannosidase binding domain of Atg34XX
17008SR10XX
17009mqsa ctermXX
17010Tryptophan apo-repressorXX
17011E2[296-331] segment of Hepaptitis C VirusXX
17012Tryptophan apo-repressorXX
17013Tryptophan apo-repressorXX
17014ChxR monomerXX
17017MmT2AXX
17018DAXX helical bundleXX
17019DAXX / Rassf1C complexXX
17020CV 0373(175-257) proteinXX
17021MaR143AXX
17022CmR116XX
17023Znf A20XX
17024Znf A20:ubiquitin complexXX
17025BvR153XX
17026BtR375XX
17028Bacteriophage Lambda Tail Tube-gpV-CXX
17030HR4694FXX
17031SLR0335XX
17032CKR-PNGXX
17033Nonsense mRNA reducing factorXX
17035asr4154XX
17036pja1 zinc finger domainXX
17038SlR115XX
17039MvR254AXX
17040TM VIXX
17041holoTrpR dimerXX
17042nNOS fragmentXX
17043TMS2 domain of Dengue virus NS4A proteinXX
17044Rtt103 CTD complexXX
17045KSR1 CA1 monomerXX
17046holoTrpR dimer L75F variantXX
17047holoTrpR dimer A77V variantXX
17048AP180 M5XX
17052BLBC/CTO complexXX
17053Cc6/Cf complexXX
17054BSA/SXX complexXX
17055CR56/RAPd1 complexXX
17056Aa2/HLT complexXX
17057MbCN/PLM complexXX
17058AngII/CE complexXX
17059STAM1/ubiquitin complexXX
17060RPA32C/TIPINXX
17061S100BE72A/CA complexXX
17064ASRXX
17065STAM1 VHS-UIMXX
17069E73 HomodimerXX
17070talin domain CXX
17071Cbx3 H3K9me3 complexXX
17072Cbx7 H3K9me3 complexXX
17073CBP in complex with p53 TADXX
17074SynArsCXX
17075TatAdXX
17076SynArsCXX
17077SynArsCXX
17078tRNALeu monomerXX
17079PROTEINXX
17080Shc-PTB complex with Integrin beta3XX
17081Prion with Y169G mutationXX
17082mouse prion protein with mutation F175AXX
17084prionXX
17087Prion with Y169A, Y225A, Y226A mutationXX
17088P6.1 hairpinXX
17089SH3 monomerXX
17090YP 399305.1XX
17091PROTEINXX
17092DNA-binding protein SATB1XX
17093mMjCM-TSA complexXX
17094DNA 1/berenil complexXX
17095EIN HPr complexXX
17096DHFR unfoldingXX
17097NP2(L122V0)/IMD complexXX
17098RSP2/ATP complexXX
17099ribonuclease/EDTA complexXX
17100P85ALPHA/pY complexXX
17101AMP2/CTO complexXX
17102C2A/CA complexXX
17104YP 001336205XX
17105NP 954075.1XX
17107Human Insulin MutantXX
17108Human Insulin MutantXX
17109Family D SortaseXX
17112PKC-delta C1BXX
17113PKC-delta C1AXX
17114H2AZH2B/Chz1 complexXX
17115PGK amide exchangeXX
17116myoglobin/pyridine complexXX
17118PAZ/ZN/NiR complexXX
17119SLN/SERCA complexXX
17120cytc/1MZ complexXX
17121PISH3 refoldingXX
17122TIM/G3PXX
17123alphaL/CA complexXX
17124NP 888769.1XX
17126Heparanase 158-417XX
17131N-terminal domain of fibroin 1XX
17132amino-terminal UBA domain of OTUD7AXX
17133EWSXX
17135Drosophila Frataxin monomerXX
17138MBD2/p66-alpha complexXX
17144ApcAXX
17145Pitx2 homeodomain R24HXX
17146ApcAXX
17147Pitx2 homeodomainXX
17148MS1XX
17149Fyn SH3 A39V-N53P-V55LXX
17150phosphotransferase IIBXX
17153thiostreptonXX
17154Thiostrepton(oxi,9)XX
17155Thiostrepton(epi,9)XX
17156Thiostrepton(red,14)XX
17160CBP21XX
17162DronpaXX
17163DronpaXX
17169HR4527EXX
17170tvMyb2 MRE-1XX
17171SWIRMXX
17172RNase A C-dimerXX
17173Nrd1 CIDXX
17174Mouse prion proteinXX
17175SP 0782 homodimerXX
17176BT 0084 lipoproteinXX
17177visual arrestinXX
17178HSA/DTPA complexXX
17179rhGH hydrogen exchangeXX
17180HSA/TEP complexXX
17181ubiquitin ratesXX
17182FucP/arabinose complexXX
17183RasMg/GppNHp complexXX
17184gal1/LATXX
17185cyclo/integrin complexXX
17186Abeta/CU complexXX
17187profilinI/pLp complexXX
1718835-MERXX
17189Rpp30XX
17190Complex Rpp30XX
17191MvR76XX
17192HR4495EXX
17195UBA monomerXX
17196Cu-binding proteinXX
17199spRT6XX
17200UHRF1 Tandem Tudor Domains/Histone H3 complexXX
17203Acyl carrier proteinXX
17204ubiquitin-like small archaeal modifier proteinXX
17206VHD monomerXX
17207SnR168AXX
17208NBD(1-388)XX
17209NBD(1-388)XX
17210NBD(1-392)XX
17213Mouse prion protein (121-231) with the mutation Y169AXX
17215OMcb5/Cc complexXX
17216PPBS/NCp7(12-55) exchangeXXX
17217SARS/dT10 complexXXX
17218CypA/peptide complexXX
17219YiiL-dimer/RNS complexXX
17220BABP/GCHXX
17221AZAMIF electron self exchangeXX
17222operator/repressor complexXXX
17223Ark1p/SH3 complexXX
17224CRT/ERp57 complexXX
17225CSD/ssDNA complexXXX
17226trHbN cyanometXX
17227GS-alfa-Ktx5.4 SCORPION TOXINXX
17231ArsD homodimerXX
17232PlyG (E.C.3.5.1.28)XX
17233PlyGXX
17234Lrp DNA-binding domainXX
17235ACP18XX
17240Influenza HA fusion peptide(G13A)XX
17241YAPXX
17243PROTEINXX
17244PROTEINXX
17245CCL21 SLC 6Ckine Exodus-2XX
17249R2XX
17250GNA1946XX
17251SARS-CoV main protease N-terminal domainXX
17256PROTEIN STE5XX
17258Pineapple CystatinXX
17260UCHL1 S18Y variantXX
17263Small archaeal modifier protein 1 from Methanosarcina acetivoransXX
17265Fusion proteinXX
17267uncharacterized thiredoxin-like proteinXX
17268Thioredoxin CXX
17270Brd3 in complex with GATA-1 C-tailXX
17275thioredoxinXX
17276unbound Alk5 ectodomainXX
17277putative thioredoxinXX
17278TgADF MonomerXX
17279rat epididymal lipocalin 12XX
17280BvR159XX
17281Alyteserin-1CXX
17282IscUXX
17284E2 lipoyl domainXX
17285PHD finger (PHD1) from CHD4 (Mi2b)XX
17286hRpn13XX
17288SaMazFXX
17289Stromal Interaction Molecule 2XX
17290hNLG3cytXX
1729226-MERXX
17293Zn-Dph4XX
17296GLP-2XX
17297GLP-2XX
17298sso1118XX
17301Sso7c4XX
17302human liver fatty acid binding proteinXX
17303human liver fatty acid binding proteinXX
17304OR28XX
17305NLRP12 PYD monomerXX
17306NR1CXX
17307HIV-1 Capsid in complex with stapled peptide InhibitorXX
17312Tah1 complex with C-terminus of Hsp90 (MEEVD)XX
17314Nonphosphorylated Peptide Recognizing DomainXX
17315C-terminal dsRBD of the Fission Yeast DICERXX
17316T box riboswitch Specifier domain and GA motifXX
17318YP 001092504.1XX
17319NP 253742.1XX
17320YP 926445.1XX
17321W protein of bacteriophage lambdaXX
17323HR6188AXX
17324Mus81-winged helix domainXX
17325Engrailed 2XX
17326RP1XX
17328CIB1XX
17329PROTEINXX
17330GIPXX
17331GIP in Bicellular mediaXX
17332vbs2bXX
17333JD/UB complexXX
17334EGF/CA compplexXX
17338EGF34/CA complexXX
17339AREA/GATA complexXXX
17340cytc/MABE8 complexXX
17341CYP 2D6/MPTP complexXX
17344CHD4-PHD2/H3K9me3 complexXX
17345PROTEINXX
17350vbs2aXX
17355meACPXX
17358nectin-1XX
17359CfR130XX
17360calcium-calmodulin complexesXX
17362E2-25KXX
17363DomBXX
17364PTB Domain of TENC1 in complex with the peptide of DLC1XX
17365ASHH2 a CW domainXX
17368MS2XX
17369MS2XX
17370protein BVU 1572(27-141)XX
17371hs00113XX
17373pdz domainXX
17374ADF/Cofilin from Trypanosoma bruceiXX
17375hPCNA trimer complexed with C-terminal region of p21XX
17376hPCNA trimer complexed with C-terminal region of p21XX
17377Sans CEN2XX
17378PROTEINXX
173795'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINEXX
17380RBP56 ZnFXX
17381putative surface proteinXX
17382Raf-1 kinase inhibitor proteinXX
17383Crimean Congo Hemorrhagic Fever Virus Cytoplasmic Gn TailXX
17385TEX13A ZnFXX
17386RBM10 ZnFXX
17387RBM5 ZnFXX
17388USP13XX
17396Zn bound FCS domain of hPh1XX
17398A protein from fission yeastXX
17400TRAP11XX
17403HlyB-C39XX
17407homeodomainXX
17411CHIPXX
17412GABARAPL-1 and NBR1-LIR complexXX
17413TRAP11XX
17414RecAXX
17415cytochrome P450camXX
17416LpxC/CHIR-090XX
17417LZ5XX
17419HTH-TYPE TRANSCRIPTIONAL REPRESSOR CYTRXX
17421C6orf130XX
17422Cidofovir DNA duplexXX
17423Control DNA duplexXX
17424Integrin 1XX
17427p21 kinase inhibitory domain bound to Cdk2 and Cyclin AXX
17429CpcCXX
17431outer membrane protein RcsFXX
17434C-terminal domain of Bv3FXX
17435C-terminal domain of Salmonella H-NSXX
1743645-MERXX
17437Ube2SXX
17439ubiquitinXX
17440trans-Resveratrol in complex with the cardiac regulatory protein Troponin CXX
17443Solution structure of human ubiquitin conjugating enzyme Rad6bXX
17444LR11 SorLAXX
17445Akap79MXX
17446SAP97NPDZ1XX
17447MUP11XX
17448protein YP 546394.1XX
17452Pitx2HDXXX
17453ccl5XX
17456THAP domain of human THAP11XX
17457b5 exchangeXX
17458Thymosin-Alpha1XX
17459dynaminPHdomain/IBS complexXX
17460L9XX
17461GroELXX
17462EGF/CAXX
17463MMOB/MMOBHa/MMOBHb/MMOBHg complexXX
17464FGF/NTS complexXX
17465aII exchangeXX
17467VRN1 B3bXX
17468NS5A fragment (191-369) monomerXX
17469ClpP F-SXX
17470TI892XX
17471p38 alphaXX
17473Chimera monomerXX
17475Structural basis of p63a SAM domain mutants involved in AEC syndromeXX
17477Mouse MFG-E8 C2 DomainXX
17481SeR147XX
17482Hsp12XX
17483hsp12XX
17484HR6470AXX
17485mSin3A PAH2-Pf1 SID1 ComplexXX
17487monomer of ICL3 (residues A221 to K345) 5-HT1AXX
17490C-terminal domain of Prp24XX
17491L4CXX
17492Thuricin CDXX
17495Thuricin CDXX
17498alpha-synucleinXX
17499Ure2p70-354XX
17500papiliocinXX
17501NP 344798.1XX
17502NUCLEAR AND CYTOPLASMIC POLYADENYLATED RNA-BINDING PUB1XX
17503fusbXX
17507DJ-1 proteinXX
17508HR6430AXX
17509YP 557733.1XX
17510protein ligand complexXX
17511LZ-GCN4 dimerXX
17512primase CTDXX
17513Immunity protein 7XX
17515INAD PDZ5 complexed with Kon-tiki peptideXX
17523Norwalk virus proteaseXX
17524hr55460aXX
17525ATR13XX
17529Nedd4LW3/smad3 complexXX
17530AHSA1-like protein RHE CH02687 (1-152)XX
17532CaBP1XX
17534SpaI monomerXX
17536Complex of SUMO1 with RanBP2 M-IR2 SIM peptideXX
17537Human minimembrane protein OST4XX
17538second WW domain from human YAP in complex with a human Smad1 derived peptideXX
17539first WW domain of human YAP in complex with a human Smad1 doubly-phosphorilated derived peptideXX
17540human Yap in complex with a human Smad1 derived peptideXX
17541human Smurf1 in complex with a phosphorylated human Smad1 derived peptideXX
17542human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptideXX
17543first domain of human Smurf1 in complex with a human Smad1 derived peptideXX
17544second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 (res 178-189) derived peptideXX
17545first domain of human PIN1 in complex with a human Smad3 derived peptide( resi 173-186)XX
17550RINGXX
17552Ph SAM linkerXX
17553acyl CoA binding proteinXX
17554tandem UBA of USP13XX
17555vbs1XX
17556yPEPmin of Rsa1pXX
17558CHR/DPC micelleXX
17559FZL2 (monomer)XX
17560FZL4 (monomer)XX
17566TASL1XX
17567TASL2 (monomer)XX
17568TASL3 (monomer)XX
17570Ure2p prionXX
17574yeast RNase III dsRBD complex with a non-canonical RNA substrateXXX
17575C domain of Rv0899XX
17578H/ACA RNP protein Nhp2p-S82W mutantXX
17579H/ACA RNP protein Nhp2pXX
17580Myc G-quadruplexXX
17583thurincin HXX
17584Thp5XX
17585Rv0020c NterXX
17586Rv0020c FHAXX
17589Prp24-RRM3XX
17590Anabaena sensory rhodopsin transducerXX
17591Anabaena Sensory Rhodopsin Transducer with F-tailsXX
17592Anabaena Sensory Rhodopsin Transducer with DNAXXX
17594hs00411XX
17596DewAXX
17597Rv0577XX
17599Par-6XX
17600Par-6XX
17602Phosphomannomutase/Phosphoglucomutase MonomerXX
17606RBBP1 chromobarrel domainXX
17607RBBP1 tudor domainXX
17608RLIP76-GAP-GBDXX
17609Hr4436BXX
17611Rmet 5065XX
17612OR38XX
17613OR36XX
17614UCP2XX
17616plasmodium falciparum ribosomal lateral stalkXX
17620D2 domain of human fibroblast growth factor receptor 4XX
17626Act2-EF34-palladin complexXX
17627alpha-actininXX
17628Alk1XX
17629Nbp2 SH3 and Ste20 peptideXX
17630JAZ ZF1XX
17631JAZ ZF2XX
17633BC28.1XX
17634Cytidine Repressor DNA-Binding DomainXX
17635FUS/TLS RRM domainXX
17636Grx domainXX
17637short Grx domainXX
17638Ebolavirus Fusion Loop pH 5.5XX
17640EL222 monomerXX
17643YtvA DimerXX
17645myosin VI lever arm extensionXX
176476BXX
17648A30P alpha-synuclein fibrilsXX
17650AbrBXX
17651CheAXX
17652S108C mutant of Phosphomannomutase/PhosphoglucomutaseXX
17653SAP30 and PAH3XX
17655Human Telomeric DNAXX
17656P1 endolysin LyzXX
17660LmrA-NBD ADP complexXX
17661srtx-i3XX
17662srtx-mXX
17663ORF57 56-140XX
17664ORF57 103-120XX
17669Trp-Cage mini-protein with D-amino acidXX
17670AaR96XX
17671RNA (27-MER)XX
17672JAZ ZF4XX
17673TDRD7XX
17675NTL9 V3AI4A double mutantXX
17678HRas166XX
17679JAZ ZF3XX
17680CBLB-pY-H-RINGXX
17682RNA (31-MER)XX
17683HR3023CXX
17685Zuo1XX
17687PARP-1 BRCT domainXX
17688TfR85AXX
17689Uracil-DNA glycosylase inhibitor p56XX
17691Sox2XX
17692Dynein Light Chain 8XX
17693RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptideXX
17694GH84A CBM32-1XX
17695Extracellular domain of GLICXX
17697G-quadruplexXX
17700TRX IntactXX
17701ykud no mutationsXX
17702protein complex for DNA replicationXX
17703RDE-4DCXX
17705SRSF2 RRMXX
17706SRSF2XXX
17707SRSF2 RRM/RNA complexXXX
17708N-mycXX
17709N-mycXX
17711SMN-Gemin2 complexXX
17714human prion protein mutant HuPrP(90-231, M129, V210I)XX
17716Cu(I)Cu(II)-CopKXX
17717NMR Structure of Mouse ApoAI(1-216)XX
17718staph-nucl-H124LXX
17719esophageal cancer-related gene 2XX
17723ChR145XX
17724KSR1 CA1-CA1a domainXX
17725KSR1 CA1-CA1a domainXX
17727KcsA-Kv1.3 (Closed state)XX
17729C-Terminal domain of LerXXX
17731(E15G)-Crp4XX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNAXXX
17733(R7G)-Crp4XX
17734PipB2XX
17735sf3636XX
17736AHSA1-like protein CHU 1110XX
17737HopPmal 281 385XX
17738HIV-1 CAXX
17739HopAB1Pph1448 220 320XX
17740HckXX
17741ETV6 Q436XX
17742ETV6 R458XX
17744KcsA-Kv1.3 (Inactivated state)XX
17745PFV RNase HXX
17747LpR145JXX
17748ERK2XX
17749entityXX
17750N-terminal domain of E3 ligase HECW2XX
17751DiironXX
17752hPRLR-D2XX
17753HR3111A dimerXX
17754MucBPXX
17755Reg I-alpha monomerXX
17762BS-RNaseXX
17764AbetaXX
17765EASXX
17766E133-222XX
17769UbiquitinXX
17770VDRLBDXX
17771CaM-OLFp complexXX
17773MS1XX
17777Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiGXX
17780Human prion protein with E219K protective polymorphismXX
17784PhyRSL-NepR complexXX
17785KRas171GNPXX
17793Abeta(1-42)XX
17794Abeta(1-42)XX
17795Abeta(1-40)XX
17796Abeta(1-40)XX
17799YP 001302112.1XX
17803InsulinGRXX
17804AATXX
17805single polypeptide chainXX
17806YP 001302112.1XX
17807Ca2+/CaM L-selectin peptide complexXX
17808Structure of PHD domain of UHRF1 in complex with H3 peptideXX
17809AHSA1-like protein AHA 2358XX
17811MsPTHXX
17812R2 of histone H3 tail by UHRF1 PHD fingerXX
17813NMR structure of the UHRF1 PHD domainXX
17815IMP1 KH34XX
17817GPRXX
17818FKBP-type peptidyl-prolyl cis-trans isomeraseXX
17819Hck32L/NefXX
17820IsdH-N2N3 monomerXX
17821Human C30S/C59S-Cox17 mutantXX
17822QFMFXX
17824Rbx1XX
17825HSJ1aXX
17826galectin-7XX
17828HOIL-1 UnlXX
17829C2 DomainXX
17832HISTONE CHAPERONE RTT106XX
17833Skint1 IgVXX
17836IscUXX
17837IscUXX
17839Ga98XX
17840GB98XX
17841GB98-T25I,L20AXX
17842OprHXX
17843GB98-T25IXX
17844IscU:IscSXX
17845yCcXX
17846yCcXX
17847hCcXX
17848hCcXX
17849yCaM 123XX
17850yCaM GS CNA1XX
17853DTAXX
17855NHP1XX
17857S100A1E32QXX
17860RNA (37-MER)XX
17861RNA (37-MER)XX
17862Staphylococcus aureus IsdH linker domainXX
17864CTD monomerXX
17866S100PXX
17867Myosin Binding Protein-C MotifXX
17868MUC2 Mucin Domain PeptideXX
17869MUC2 Mucin Domain Peptide, SUGAR (3-MER)XX
17870MUC2 Mucin Domain Peptide, SUGAR (2-MER)XX
17871Mucin Glycoprotein RecognitionXX
17872MUC2 Mucin Domain PeptideXX
17873Mucin sequence based on MUC2 Mucin glycoprotein tandem repeatXX
17874MUC2 Mucin Domain PeptideXX
17875MUC2 Mucin Domain PeptideXX
17876Novel Toxin from De Venom of the Scorpion TityusXX
17878La(4-325)XX
17879Atg8K26PXX
17880yeast proteinXX
17881C-CaM apo formXX
17882CssIIXX
17883Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNAXXX
17888Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392XX
17889NvVgXX
17890CCL2 (free)XX
17891kkgfXX
17892CylR2 homodimerXX
17893CylR2 homodimerXX
17894CylR2XX
17895CylR2XX
17896CylR2XX
17897CylR2XX
17898CylR2XX
17899MS1XX
17900BfR322XX
17901SpliceosomeXX
17902CCL2 (+carbohydrate)XXX
17903Iso-1-cytochromeXX
17904Iso-1-cytochromeXX
17905GED rrACBcsXX
17908Acidic Scorpion Potassium Channel ToxinsXX
17911Mpro-CXX
17912third SH3 domain of R85FLXX
17914MerFtXX
17915SH3XX
17916Tfg2XX
17917Tfg1 C-terminal domainXX
17918TbPIN1XX
17921GAAA tetraloop monomerXX
17922NefXX
17924SEVIXX
17925SEVIXX
17927putative thiol-disulfide oxidoreductaseXX
17930monophosphorylated (747pY) beta3 integrinXX
17931biphosphorylated (747pY, 759pY) beta3 integrinXX
17932monophosphorylated (747pY) beta3 integrinXX
17934AIDA1 PTB domainXX
17935GATase subunit (monomer) of GMP SynthetaseXX
17936dADAR-dsRBD1XX
17937CAP-GlyXX
17938CAP-GlyXX
17940p38alphaXX
17941IV-B RNAXX
17942Complex of hDlg and E6XX
17943CGC-19XX
17944C-terminal Trx reassemblyXX
17946Dihydrofolate reductase from Moritella profundaXX
17948Hsp12XX
17949CssIIXX
17950AtTRB2XX
17952C5 protein monomerXX
17953NMR Structure of protoporphyrin-IX bound murine p22HBPXX
17955(C9S, C14S)-leucocin AXX
17957BA42XX
17958C9L,C14L-LeuAXX
17961U2U6111XX
17962putative oxidoreductase from Ehrlichia chaffeensisXX
17964HIV-1 PR HomodimerXX
17965NsR264XX
17967N-terminal domain of HPV16 E6 oncoproteinXX
17968HPV16 E6XX
17971TGIF1XX
17972U2/U6snRNAXX
17973onconase FLG variantXX
17978MPG1XX
17979Zn(II) form of DesulforedoxinXX
17980G-quadruplexesXX
17981C-CaM/PEP-19 complexXX
17982C-CaM/Ca complexXX
17983C-CaM/PEP-19 complexXX
17985BST-2XX
17986cyclic gomesinXX
17987Ts16XX
17989UUP protein C-terminal domainXX
17991Nicotinic Acetylcholine ReceptorXX
17992Nicotinic Acetylcholine ReceptorXX
17994HIV-1 PR HomodimerXX
17995NE2163XX
17996HIV-1 PR HomodimerXX
17997Cd(II) form of DesulforedoxinXX
17998FKBP42XX
17999ATSXX
18001AIPXX
18002Kindlin-2XX
18003apo-NmtRXX
18004Structural and functional analysis of the DEAF-1 and BS69 MYND domainsXX
18005Molecular systemXX
18006Molecular systemXX
18007Molecular systemXX
18008Molecular systemXX
18011Tb24XX
18012N-terminal domain of human TIG3XX
18015PITX2XXX
18016SSGCIDXX
18018YP 916642.1XX
18022Cx43 C-terminal domain bound to tubulinXX
18023Cyclo-TC1 Trp-cageXX
18026guanylyl cyclase activating protein-1, GCAP1XX
18029sf-ALRXX
18031Fap7XX
18032RPA2022XX
18037ykud imipXX
18045EMAP2XX
18047NP 814968.1XX
18048NPM1 C70XX
18049RNA-binding subunit of the TRAMP complexXX
18051myb-like1 domain of hDMP1XX
18052MS2XX
18053hs499XX
18080amyloid precursor protein's transmembrane domainXX
18082Calmodulin N-lobe bound with ER alpha peptideXX
18084Calmodulin C-lobe bound with ER alpha peptideXX
18085AlvinellacinXX
18086YjdKXX
18087S100A1C85MXX
18088Post-translational S-nitrosylationXX
18089Post-translational S-nitrosylationXX
18090DP1XX
18091DP2XX
18092NeRF1XX
18093transmembrane domains of the a4b2 nAChRXX
18095FR824DXX
18096nAChRXX
18097rhesus SPRY domainXX
18098YT682AXX
18099CIB1XX
18102Cysteine Deleted Analog of Tachyplesin-1XX
18110C-terminal RAGE (ctRAGE)XX
18112HR4660BXX
18113allergenic beta parvalbuminXX
18114human LL-23XX
18115C-terminal Domain (537-610) of Human Heat Shock Protein 70XX
18116ubiquitin monomerXX
18119ITK-SH3XX
18121CdnL N-terminal domainXX
18122Photoactive Yellow ProteinXX
18133AK1XX
18134FIRST SAM DOMAIN OF ODINXX
18138MDR 769 homodimerXX
18145OR135XX
18146coprisinXX
18147RbfAXX
18148VEGFR-2XX
18151CdnLXX
18153thermomacinXX
18154YqcA from Escherichia coliXX
18156HR6741AXX
18157Avh5XX
18158N-terminal domain (6-74) of human ZBP1 proteinXX
18161OR134XX
18166HR4403EXX
18167PsbPXX
18169Ca-bound S100A4 in complex with non-muscle myosin IIAXX
18171atTic-hip/hop domain (Residue 310-371)XX
18176cytosolic region of human VIMPXX
18177cytosolic region of human VIMPXX
18178AGR2 residues 41-175XX
18179E60A mutant AGR2XX
18180HmR11XX
18182Vav2 and Arap3XX
18183Vav2XX
18188CohA2XX
18189DocAXX
18190BC008182XX
18193TtCdnLNtXX
18194CarD1-72XX
18195optn 550XX
18196proteinase inhibitorXX
18197angiogenin monomerXX
18198NIPP1 monomerXX
18200RstA CXX
18201HasR N-terminal periplasmic signaling domainXX
18202hNaa50pXX
18203Mu-contoxin BuIIIBXX
18204hPEBP1XX
18205PDZ Domain of CAL and C-terminus of the CFTRXX
18206Conotoxin analogue [D-Ala2]BuIIIBXX
18209DNA molecule G3ATG3ACACAG4ACG3XX
18211Lotus domains 2 and 3XX
18214tstm1273XX
18215HsR50XX
18216acyl-carrier protein from Rickettsia prowazekiiXX
18228TpbA monomerXX
18229complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2XX
18230S100A1 dimerXX
18231S100A1 homodimerXX
18234P1-CheY/P2 complexXX
18236cruzainXX
18238APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XLXX
18242PYNOD PYDXX
18244complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15XX
18249CcmGXX
18250Bcl-XLXX
18251Cdc42HsXX
18252Cdc42HsXX
18253P1 endolysin LyzXX
18255MbtH-like proteinXX
18256monomeric phospholamban (C36A, C41F, C46A)XX
18257DmsDXX
18260R17XX
18263RPA2022XX
18265WIP C-terminal domainXX
18266Dengue Virus NS2B/NS3 in complex with AprotininXX
18267DNA Polymerase beta uncomplexedXX
18268EF-hand domain of polycystin-2XX
18269N-terminal domain of human CDNFXX
18276PrgI needleXX
18277KmAtg10XX
18278FKBP12 from Aedes aegyptiXX
18281StrawberryXX
18284antifreeze peptide 1mXX
18285HLA-DR1/CLIP102-120canonicalXX
18286antifreeze peptide 3XX
18287PAP248-286XX
18288Ninjurin1 monomerXX
18289antifreeze peptide 4mXX
18290SnR212XX
18296BRD1 PHD2 fingerXX
18297Uba3XX
18298NusGXX
18299K60A mutant of Atox1XX
18300Solution NMR structure of asteropusin A from marine sponge Asteropus sp.XX
18301MBD2XX
18302calcium-bound CaM N-terminal domain in a complexXX
18304HEWLXX
18305HEWL-chitotrioseXX
18306A2POBEC2 41-224XX
18307A2POBEC2 1-224XX
18308HLA-DR1/CLIP106-120flippedXX
18309FliGn homodimerXX
18310FliGn-FliFcXX
18312PiCyp AXX
18313A domain of talinXX
18314FOXO3aXX
18315FOXO3aXX
18317sugarcane cystatinXX
18319Y4 TM1-TM2XX
18322reduced Mrx1XX
18323calcium-bound CaM C-terminal domain in a complexXX
18325oxidized Mrx1XX
18326Ni(II)-bound NmtR homedimerXX
18327atypical SH3 domain of DOCK180XX
18329DBPAXX
18331MS1XX
18332Escherichia coli PorinsXX
18335gH625-644XX
18336RNA (27-MER)XX
18337OR136XX
18338PPcXX
18340Bax+vMIAXX
18341Sgt2 NT homodimerXX
18342Get5 UBL domainXX
18344assemblyXX
18345anti-fungal defensin DEF4 (MTR 8g070770)XX
18346NP 390037.1 from Bacillus subtilisXX
18347micasinXX
18348EB1 CH domainXX
18349RF2209AXX
18350cathelicidin-PYXX
18351MS3XX
18352HR8150AXX
18353Kelch domain of mouse Keap1XX
18355Rv0603-SSDXX
18356ADF like UNC-60A ProteinXX
18359IscU(D39V)XX
18360IscU(E111A)XX
18361IscU(N90A)XX
18362IscU(S107A)XX
18363Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptideXX
18364GS13500A assemblyXX
18365WT-ALAXX
18366W28GXX
18367W62GXX
18368W108GXX
18369W111GXX
18370W123GXX
18371EB1 C-terminal domainXX
18372OR137XX
18373bLACXX
18374AIRE-PHD2XX
18375staphyloxanthin proteinXX
18380dvCcmE'XX
18381IscU-HscAXX
18385H3(1-59)XX
18386HP1 CSDalpha(109-185)XX
18387thiol:disulfide interchange proteinXX
18388CtCBM11XX
18389CtCBM11XX
18390Fr822AXX
18392EIC dimerXX
18394uncharacterized thioredoxin-like protein BVU 1432XX
18396nanocrystalline DsbAXX
18398WNK1 Autoinhibitory DomainXX
18399ubiqutin-like protein from Trypanosoma buceiXX
18403UIM-SH3 monomerXX
18404Target Recognition Domain of Zoocin AXX
18411putative protein disulfide isomeraseXX
18412phosphoprotein enriched in astrocytes 15AXX
18413AdcRXX
18414AdcRXX
18415human C-type lectin domain family 4 member DXX
18416ubiquitin homology of mouse BAG-1XX
18417H6-hBASP1XX
18419B2 domain of Neisseria meningitidis Pilus assembly protein PilQXX
18421eiavCA monomerXX
18425S100A11 dimerXX
18426human prion proteinXX
184272'F-ANA and ANA self-complementary duplexXX
18428PilQXX
18429OR188XX
18431mouse Rev1 C-terminal domainXX
18433mouse Rev1 CTD in complex with the RIR of Pol KappaXX
18434C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)XX
18435C-terminal domain of Tetrahymena telomerase protein p65XX
18437gpFI C-terminal domainXX
18438HR7057AXX
18440Analog of the fragment 197-221 of 1- adrenoreceptorXX
18442R. rickettsii cold shock-like proteinXX
18443thioredoxinXX
18446Apoform of HahellinXX
18448NIPP1 1-143XX
18449SBMXX
18452Synthetic cyclic oligonucleotideXXX
18455REV1-CTXX
18458HIRAN domainXX
18459N0 domain of Neisseria meningitidis Pilus assembly protein PilQXX
18462KaisoXXX
18463EurocinXX
18464NCX3XX
18465OR157XX
18466Wild-type FAS1-4XX
18467FAS1-4 R555WXX
18469YdbCXX
18470Cu(I) gt CsoRXX
18471PWWP domainXX
18472Apo form gt CsoRXX
18473L-PGDS/U-46619 complexXX
18474pwwp domain of TFIIS2-1XX
18475P2 gpXXX
18477A.fAglB S2XX
18478P75/LEDGF PWWP DomainXX
18479HRas166XX
18484G5XX
18485Tb 1-C-Grx1 monomerXX
18487YR313AXX
18489HR2876BXX
18492SANT2 domain of NCoR2XX
18494TM0026 monomerXX
18496YdbC:dT19G1 complexXXX
18497autoinhibitory domain of human AMP-activated protein kinase catalytic subunitXX
18498YAP WW2 in complex with a Smad7 derived peptideXX
18499YAP WW1 in complex with a Smad7 derived peptideXX
18500Smurf1 WW2 domain in complex with a Smad7 derived peptideXX
18501NEDD4L WW2 domain in complex with a Smad7 derived peptideXX
18502Smurf2 WW3 domain in complex with a Smad7 derived peptideXX
18503RNA (49-MER)XX
18504pfsub2XX
18505MHV N NTDXX
18507beta2 carbohydrate module of AMP-activated protein kinaseXX
18508beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrinXX
18511HR8578DXX
18513recombinant tamapinXX
18514MSL2XX
18515RNA (37-MER)XX
18517EDK-delta-Bd37XX
18518LC3B OPTN-LIR Ptot complex structureXX
18520S72-S107 peptide of 18.5kDa murine MBPXX
18521Vta1-Vps60 complexXX
18522PICK1 PDZ domain fused to the C10 DAT ligandXX
18524DNA OUHXX
18526HR3504CXX
18529K-Ras-GDPXX
18531GB3XX
18533mptpaXX
18534Ribonuclease III in complex with RNA (32-MER)XXX
18535Ribonuclease IIIXX
18537collagelinXX
18538GPVI peptide mimeticXX
18542Cytosolic Tails of aXb2 IntegrinXX
18543DsbA(C33S) proteinXX
18544DsbA(C33S)XX
18545C85M S100A1 dimerXX
18547MiR12XX
18548Fam96aXX
18550V210IXX
18551C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497)XX
18555PA1075XX
18557Ca2+-bound CaBP7 N-terminal domanXX
18558OR16XX
18559MLL5XX
18560hs356 22 132XX
18561OR250XX
18562VvMARTXXX
18563HR8578KXX
18565MLD PMTXX
18566TL-domainXX
18567S114A mutant of UVI31+XX
18568NS4BXX
18569EVH1XX
18570zinc finger AFV1p06 proteinXX
18571apo-Phl p 7XX
18572hemi-Mg-bound Phl p 7XX
18573Ca-bound Phl p 7XX
18574wild-type Lipase AXX
18575variant XI LipAXX
18579Methylated Histone ComplexXX
18580H6-vMycCtermXX
18587MHV nsp3a momonerXX
18588Tyr tRNA SynthaseXX
18589Cbp2XX
18591ilvNXX
18592MRH domainXX
18595ASRXX
18598LytTR domainXX
18599FH11-12XX
18600S67XX
18602soluble domain of MmpS4XX
18604Solution structure of CCP modules 10-11 of complement factor HXX
18605HR8682BXX
18606anti-CRISPR protein Acr30-35XX
18607Avrpiz-tXX
18608ASC PYDXX
18615Par17XX
18617G8A mutant of the influenza hemagglutinin fusion peptideXX
18620RRM domainXX
18621La-type RNA-binding domainXX
18622second CARD of human RIG-IXX
18623mutant (T170E) second CARD of human RIG-IXX
18624N-terminal domain of a plant GrxXX
18627VILIP-3 monomerXX
18630N-80 ALRXX
18631N-80 ALR reducedXX
18634human beta-defensins 1 and 6XX
18635HbD1XX
1863811 mer oligonucleotide-BXX
18639Duplex DNA Containing a b-Carba-Fapy-dG LesionXX
18640Duplex DNA Containing a b-Carba-Fapy-dG LesionXX
18641PawS derived peptide 11 (PDP-11)XX
18642ProteinXX
18643PawS Derived Peptide 4 (PDP-4)XX
18644PawS Derived Peptide 5 (PDP-5)XX
18645PawS Derived Peptide 7 (PDP-7)XX
18648APPTM V44M dimerXX
18649APPTM dimerXX
18650RelA-TAD/CBP-TAZ1 complexXX
18651MxiH needleXX
18652alpha sub-domainXX
18654Single-chain InsulinXX
18655Transmembrane Arced Helix (ArcH)XX
18657nfeAFP11XX
18658peptide a2N(1-17) from Mus musculus V-ATPaseXX
18659peptide epsilon(103-120)XX
18661CSGIXX
18667Solution structure of eIF4E3 in complex with m7GDPXX
18668FeoAXX
18672S4WYILDXX
18673potential acylphosphatase from Giardia lambliaXX
18677RING domain in ubiquitin ligase gp78XX
18678RRM1-RBM10XX
18679LmCsp dT7XX
18680LmCspXX
18681LIP5(MIT)2XX
18682LIP5-CHMP5XX
18685adenylate kinaseXX
18688gp78 RING bound to Ube2g2:G2BRXX
18689tpr2aXX
18691tpr1 domainXX
18692HP1264XX
18693Exocrine gland-secreting peptide 4XX
18694KIX domain complexXX
18695KIX domain complex (3)XX
18696rmodNXX
18697rmodN-ACSL complexXX
18698HR8614AXX
18701UNC-60B from Caenorhabditis elegansXX
187032-mercaptophenol-alpha3CXX
18704Siglec5 CRDXX
18705Antimicrobial Peptide Human Defensin 5XX
18707TamA POTRA domain IXX
18709HMG-box/p53XX
18711CH3CSXX
18714HR7907FXX
18715MAXX
18716HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serineXX
18717Ska1-MTBDXX
18718alpha 4 integrin tailXX
18719beta 2 integrin tailXX
18720Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptideXX
18724G-quadruplex DNAXX
18725Faap24XX
18728UP1XX
18729MS2XX
18730West nile proteaseXX
18732NP 390345.1XX
18733NB7890AXX
18734ZP 02034617.1XX
18735HR3520OXX
18736Conotoxin TxIBXX
18738eIF4GI-HEAT1XX
18740KSR1 CC-SAMXX
18749Ligase 10CXX
18753biofilm matrix promoter AbbA from B. subtilisXX
18756WT IkappaBalphaXX
18758First Catalytic Cysteine Half-domainXX
18759CPAP IkappaBalphaXX
18760YLTA IkappaBalphaXX
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyreneXX
18763FGFR3tmXX
18765RRM1 monomerXX
18766PI-AnmTX Ugr 9a-1XX
18767Hug1XX
18768NS2(2-32) GBVB proteinXX
18769NS2(32-57) GBVB proteinXX
18770TatA T22PXX
18771TatA oligomerXX
18772SCIN-AXX
18773SCIN-BXX
18774omp synthaseXX
18775omp synthaseXX
18778LIMD2XX
18779FrpD proteinXX
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-linkXX
18781DNAXX
18783ASTEROPSIN B FROM MARINE SPONGE ASTEROPUSXX
18784ABU8-3XX
18785Erbin PDZ WTXX
18786Erbin PDZ S47XX
18788staphylococcal nuclease E43S mutantXX
18789Kunitz-type neurotoxin LmKKT-1aXX
18795Amylin monomerXX
18796OmpX in phopspholipid nanodiscsXX
18797OmpX in DPC micellesXX
18798HO-1XX
18799HO-1XX
18800HO-1XX
18801NmPinXX
18802SF1NXX
18803MHV N-linker peptideXX
18804ErbB1 (EGFR, HER1)XX
18805HR4490CXX
18806Miz58XX
18807ceN SAS-6XX
18808Nterminal domain of splicing factor 1XX
18812DUF3349XX
18813human PHF1 in complex with H3K36me3XX
18814H-NS oligomersXX
18815his-eiav-caXX
18816CR10XX
18817KCNE2XX
18818human S100A14XX
18819ApoAcpP-3XX
18820ApoAcpP-1XX
18821ApoAcpPXX
18823PpdDXX
18824extended PDZ1 domain from NHERF1XX
18825C-terminal CFTR peptide and extended PDZ1 domain from NHERF1XX
18826C-terminal CFTR peptide and extended PDZ2 domain from NHERF1XX
18827Gate16XX
18828holocytochrome cXX
18829TIA-1 proteinXX
18830ALPS-23 peptide in SDS micellesXX
18832SH3 domain of DOCK180XX
18837VHH 18XX
18838ID3 stem loop of domain 1 in the ai5gamma group II intronXX
18839monomeric sugarcane canecystatinXX
18840CPEB1-ZZ G-P-504-566XX
18841Antitoxin PaaA2XX
18842complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4XX
18844UBLCP1XX
18847stacked G-quadruplex formed by human TERRA sequenceXX
18851HIV-1 Rev ARM single polypeptide chainXX
18852HIV-1 Rev ARM peptide (residues T34-R50)XX
18853LpoA n-terXX
18856GtYybT PAS HomodimerXX
18857alpha-synucleinXX
18858Biosynthetic engineered B28K-B29P human insulin monomerXX
18859Biosynthetic engineered B28K-B29P human insulin monomerXX
18860a-synuclein fibrilsXX
18861Antiamoebin IXX
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutionsXX
18863MS1XX
18864CsPinAXX
18865OvDpl(1-30)XX
18870dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)XX
18871chaperone in type III secretion systemXX
18872ID3 stemXX
18873Lewisx-sp8 acetateXX
18874ING4 PHD mutant N214DXX
18875[Aba5,14]BTD-2, cyclic peptideXX
18877CaBP4 polypeptideXX
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybridXXX
18882TICAM-2 TIR domainXX
18883TICAM-1 TIR domainXX
18885Rpt6XX
18887hypothetical protein lmo0427XX
18888EGFR transmembrane - juxtamembrane (TM-JM) segmentXX
18891Tetrahymena telomerase RNA stem IV terminal loopXX
18892helix II template boundary element from Tetrahymena telomerase RNAXX
18893d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1XX
18894d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gammaXX
18895N-terminal MAP1B LCXX
18896BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITORXX
18897NMR structure of the glycosylated conotoxin CcTx from Conus consorsXXX
18899Doc monomerXX
18901C-terminal domain of the protein HCFC1XX
18904two domain PPIase SlpA from Escherichia coliXX
18905RRM2 domain of the protein RBM10 from homo sapiensXX
18906CHD4XX
18907Duplex DNAXX
18908Human programmed cell death 1 receptorXX
18909hs00507XX
18913[Aba3,16]BTD-2XX
18914[Aba3,7,12,16]BTD-2XX
18917tstm1395XX
18919Full-length cytochrome b5 with heme BXX
18921[L-HisB24] insulin analogue at pH 1.9XX
18923[L-HisB24] insulin analogue at pH 8.0XX
18924chain AXX
18925chain AXX
18927V5 domain of Protein Kinase C alphaXX
18928T638E/S657E V5 domain of Protein Kinase C alphaXX
18929V5 domain of Protein Kinase C alphaXX
18930T638E/S657E V5 domain of Protein Kinase C alpha, DPVXX
18931[Aba5,7,12,14]BTD-2XX
18933ASFV Pol XXX
18934Binary complex of African Swine Fever Virus Pol X with MgdGTPXX
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNAXXX
18937[Aba3,5,7,12,14,16]BTD-2XX
18938BTD-2[3,4]XX
18939C-terminal AbrBXX
18941LFA-1 I-DomainXX
18942alpha-1 integrin I-domain in complex with GLOGEN triple helical peptideXX
18944Gbx1XX
18947SpnDE1XX
18948LASSO PEPTIDE ASTEXIN-1(19)XX
189503',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEXXX
18951MYB-like DNA binding domain of KNL-2 from C. ElegansXX
18953gammaM-crystallinXX
18955STRUCTURE OF NAB2P TANDEM ZINC FINGER 12XX
18956STRUCTURE OF NAB2P TANDEM ZINC FINGER 34XX
18958Integrin L Transmembrane DomainXX
18959Rsa1p238-259XX
18963Dido PHDXX
18964Novel Alpha4/6-Conotoxin TxICXX
18965Marine Sponge-Derived Asteropsin EXX
18966ComPXX
18967E6XX
18969S55A mutant of UVI31+XX
18976Ca-containing EF-hand proteinXX
18977Phosphate-bound TpbAXX
18980NC inhibitor 3 complexXX
18986C-terminus of the minichromosome maintenance protein MCMXX
18987SACOL0876XX
18988apo paHOXX
18989CgR160XX
18990proteinXX
18991[2Fe-2S]FdxXX
18992[2Fe-2S]FdxXX
18993Alt a 1XX
18994zNTDXX
18998Allatide O4 conformation 2XX
18999allatide conf1XX
19000VV2 0175XX
19004CcP(His)6CNXX
19005(His)6CcPCNXX
19006VanUXX
19007MinC N-terminal monomerXX
19008SinR FLXX
19010Titin C1XX
19011C1CTXX
19013RRM domain of the hypothetical proteinXX
19014putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegansXX
19017Bulges in G-quadruplexesXX
19023RNA polymerase binding protein A (RbpA)XX
19024single G-bulge in a conserved regulatory region of the HEV genomeXX
19025CAP-Gly monomerXX
19027rubredoxin type protein from Mycobacterium ulceransXX
19028MBF1-CXX
19029K2A1XX
19031CAP-Gly/EB1 heterotetramerXX
19035G-rich VEGF aptamer with LNA modificationsXX
19037h-prune C-terminal domainXX
19039domain 5 from Azotobacter vinelandii Intron 5XX
190402'-5' AG1 lariat forming ribozymeXX
19041VEGFR2tmXX
19042Frataxin like monomerXX
19043Protein A binding by an engineered Affibody moleculeXX
19044PMM/PGM D4XX
19046Phosphatase domain of PTPN5XX
19047BcIIXX
19048BcIIXX
19051calcium channel beta subunitXX
19052Ebolavirus Fusion Loop L529A/I544AXX
19056IsdB N1XX
19058doublet cross-beta amyloid fibrilXX
19060triplet cross-beta amyloid fibrilXX
19061S100A15XX
19062cross-beta protofilamentXX
19063TIAR RRM2XX
19064TIAR RRM2XXX
19065RNaseAXX
19067Solution structure of latherinXX
19068HR2876CXX
19069EFGPXX
19072HIV-1 PR HomodimerXX
19074DidoPHD/H3K4me3XX
19075CcP-PPIXXX
19076CcPXX
19078fibrillin e2cb1XX
19080NS2B-NS3proXX
19081P4 CPEB3XX
19082thymidylate synthaseXX
19083SENP1XX
19085SPI-2 inhibitorXX
19086Solution structure of human ribosomal protein P1.P2 heterodimerXX
19087C-terminal RV0431XX
19088Rv2140cXX
19089adenylate kinase with ADPXX
19090adenylate kinase with ADPXX
19091adenylate kinase with ADPXX
19092adenylate kinase with ADPXX
19093adenylate kinase with ADPXX
19094Enterocin 7AXX
19095SsoSSBXX
19098Nop6XX
19099human beta-2 microglobulinXX
19101Enterocin 7BXX
19106TICAM-1XX
19108human restriction factor APOBEC3AXX
19112MS1XX
19113B2709-b2m-pVIPR complexXX
19116B2709-b2m-TIS complexXX
19117Domain 11:IGF2 complexXX
19118B2709-b2m-pLMP2 complexXX
19119B2709-b2m-pGR complexXX
19120B2705-b2m-pVIPR complexXX
19121B2705-b2m-TIS complexXX
19122B2705-b2m-pLMP2 complexXX
19123B2705-b2m-pGR complexXX
19124antimicrobial peptide Tk-Amp-X2XX
19126GlyRXX
19127lambda lysozymeXX
19128cIn936XX
19129tIn936WXX
19130cIn936MXX
19131tIn936MXX
19132ctLO959WXX
19133ttLO959MXX
19135MAP2cXX
19137ERGiXX
19138ED ComplexXXX
19139R7XX
19142vertebrate toxin from the badge huntsman spiderXX
19143FepBXX
19144CAP mutant (T127L and S128I) in the apo stateXX
19145A structural model of CAP mutant (T127L and S128I) in cGMP-bound stateXX
19146RING domain of E3 ubiquitin ligase Doa10XX
19147APC/C CDH1-EMI1: multimodal mechanism of E3 ligase shutdownXX
19153IGF2RXX
19154SungsanpinXX
19155CbpAN from Streptococcus pneumoniaeXX
19156Hedgehog Autoprocessing DomainXX
19163J-domain of human DnaJA1XX
19165HdeA homodimerXX
19167CsPABP1XX
19168C-terminal domain of translation initiation factor IF-3XX
19169PG 2175XX
19170calmodulin-binding domain of plant calcium-ATPase ACA8XX
19171TRD of MBD1XX
19172PTPN11 C-SH2 freeXX
19173PTPN11 C-SH2 boundXX
19175[Asp2]RTD-1XX
19176[Asp11]RTD-1XX
19177[Asp2,11]RTD-1XX
19178MS1XX
19179mol1XX
19180Trp-cage Circular PermutantXX
19182AprataxinXX
19183Trp-cage 16b P12W: a Hyperstable MiniproteinXX
19184calmodulin-binding domain of plant calcium-ATPase ACA2XX
19185PilAXX
19186S72-S107 peptide of 18.5 kDa MBPXX
19187Methanothermobacter thermautotrophicus MCM C-terminusXX
19193(Y81F)-EhCaBP1XX
19196(Y81F)-EhCaBP1XX
19197C-terminal structure of (Y81F)-EhCaBP1XX
19198SP18156AXX
19200LDLaXX
19201TAX1BP1 UBZ1+2XX
19202CONANTOKIN BK-BXX
19203RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1XX
19204BAF155 SWIRM domainXX
19205Engineered Cystine Knot Protein 2.5DXX
19206PcCBM36 monomerXX
19208Arginine kinase transition state analogue complexXX
19213TePixJXX
19214Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome DomainXX
19215gp41-M-MATXX
19218Grx8XX
19219Yeast Rpn9XX
19220proteasome related subunit N terminal domainXX
19221proteasome related subunit C terminal domainXX
19223PTP1BXX
19224PTP1BXX
19225GM CBM21XX
192262'F-RNA/2'F-ANA chimeric duplexXX
19231PmrAXX
19235Aha1 dimer from Colwellia psychrerythraeaXX
19238Calmodulin prototypical calcium sensorXX
192392c TCRXX
19240FKBP12XX
19241FKBP12XX
19242apo-HisJXX
19243Domain 1 from E. coli HisJXX
19244Domain 2 from E. coli HisJXX
19245HisJ and HistidineXX
19246GAP-43XX
19249PAI subdomain of Sleeping Beauty transposaseXX
19251Nlh2XX
19253tau K18XX
19257Alpha-synucleinXX
19258Pin1 WW domainXX
19260RNA (48-MER)XX
19262MPERpXX
19263MPERpXX
19266SNAREXX
19268HuPRPXX
19269E7NXX
19271CRABP1 apoXX
19275Bovicin HJ50XX
19276d[CGCGAAGCATTCGCG] hairpinXX
19277d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybridXX
19278d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybridXX
19279d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybridXX
19280d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybridXX
19281d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybridXX
19282lymphocyte receptor NKR-P1AXX
19283RXFP2 LDLaXX
19284deltaXX
19285Calcium SensorXX
19286BeF3 Activated Sma0114XX
19287NACIXX
19288HR7784AXX
19291Pin1 WW domain mutant 5-1XX
19292Pin1 WW domain mutant 5-1gXX
19293calcium-bound human S100A12XX
19294DNA-binding domain of T. brucei telomeric protein tbTRFXX
19295Pin1 WW domain variant 6-1XX
19296Pin1 WW domain mutant 6-1gXX
19299MLV CTD INXX
19301CPRXX
19302ERCC4 domain of human FAAP24XX
19303(HhH)2 domain of human FAAP24XX
19304kalata B7XX
19305an inhibitor bound dengue NS3 proteaseXX
19306an inhibitor bound dengue NS3 proteaseXX
19307UVI31+MgXX
19308UVI31+XX
19311Saccharomyces cerevisiae Est3 proteinXX
19312hr4784bXX
19314HR9151AXX
19315HHARI Catalytic DomainXX
19317DNA helicase RecQXX
19318drSTILXX
19319RasGRP2 EF hands bound to calciumXX
19320Taf15XX
19321cerato populinXX
19322LTBP1-cb14TB3XX
19323FKBP12.6XX
19324FKBP12.6XX
1932526S proteasome subunit monomerXX
19327yahOXX
19328HR7375CXX
19329HR8700AXX
19330DUSP16 MonomerXX
19331HR7992AXX
19332p15(PAF)XX
19334Temporin-1 Ta in lipopolysaccharide micellesXX
19337aSynXX
19338aSyn A53T monomerXX
19339R8XX
19344aSyn S87NXX
19345aSyn A53T&S87NXX
19346aSyn mouseXX
19347aSyn mouse T53AXX
19348aSyn mouse N87S monomerXX
19349aSyn mouse T53A&N87S monomerXX
19350acetylated aSyn monomerXX
19351acetylated aSyn A53T monomerXX
19353AS69 ASynXX
19355LassomycinXX
19357Met66 BDNF ProdomainXX
19358Val66 BDNF ProdomainXX
19361MptpAXX
19362STIM1 CC1-CC2 homodimerXX
19363STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domainsXX
19366region 2 of E. coli sigmaEXX
19368Structure of Pex14 in complex with Pex5 LVxEF motifXX
19369calbindin D9k Apo-formXX
19370calbindin D9k calcium bound-formXX
19371calbindin D9k magnesium bound-formXX
19372Ani s 5 Anisakis simplex allergenXX
19374alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosaXX
19376Calmodulin, C-terminal domainXX
19377IL10 dimerXX
19379alpha7 nAChR transmembrane domainXX
19380RNAP alpha subunit CTDXX
19381DNA/RNA (5'-D(*TP*TP*G)-R(P*(LG))-D(P*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3')XX
19383Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2XX
19384conotoxin muPIIIA-1XX
19385conotoxin muPIIIA-2XX
19386parallel-stranded G-quadruplex in DNA poly-G stretchesXX
19388MptpAXX
19389stacked dimeric G-quadruplexXX
19391MBD3XXX
19392CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous AssemblyXX
19393Abeta FibrilsXX
19394human Polymerase iota UBM1-Ubiquitin ComplexXX
19396LasiocepsinXX
19398Forkhead DNA binding domain of Brugia malayi DAF-16aXX
19399EKLF(22-40)/Ubiquitin ComplexXX
19402antiparallel (2+2) G-quadruplexXX
19404OR33 cnsXX
19407trimeric SkpXX
19408trimeric Skp with bound OmpXXX
19409Trimeric Skp with bound tOmpAXX
19410tOmpA within the tirmeric chaperone SkpXX
19411OmpX within the trimeric chaperone SkpXX
19413KpDsbAXX
19414PaDsbAXX
19415LMO4-LIM2 in complex with DEAF-1 (404-418)XX
19416Rrp7 C-terminal DomainXX
19417PaDsbAXX
19418PICK1 PDZ GluA2XX
19424RyR2A delta exon 3XX
19425mouse RyR2 domain AXX
19426kv14 pep61XX
19427BldD-CTD monomerXX
19430Salmonella MgtRXX
19432Cat r 1XX
19433YP 002937094.1XX
19435Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligandXX
19436murine norovirus NS1/2 D94E mutantXX
19438TgamXX
19439murine norovirus NS1/2 CW3 WTXX
19442E7 dimerXX
19443EC1XX
19444murine norovirus CR6 NS1/2 proteinXX
19446SSBXX
19448dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequenceXX
19449BolA-like hypothetical protein RP812XX
19451PNUTSXX
19452putative thioredoxin (ECH 0218) in the reduced state from Ehrlichia chaffeensisXX
19453SP17945AXX
19458Recombinant CR1 fragment, domains 2-3XX
19459Recombinant CR1 fragment, domains 1-2XX
19461HlyIIC-CisXX
19462HlyIIC-TransXX
19463p87m-HlyIIcXX
19464HicAXX
19466PICK1 PDZ ASIC1a C-termXX
19468WR17 LPSXX
19469WK10 LPSXX
19470KR8 LPSXX
19471WG12 LPSXX
19472Sp140 PHD finger trans conformerXX
19473Sp140 PHD finger cis conformerXX
19474uninhibited ETV6 ETS domainXX
19477P130Cas SDXX
19478TNRC6Bm1XX
19479Active Site Mutant Pepitdyl Carrier ProteinXX
19482Regulatory Domain of Tyrosine HydroxylaseXX
19483WW domain of HYPBXX
19484tm67XX
19485SVIP mutationXX
19486Hr7298fXX
19487PP2WW mutant (KPP2WW) of HYPBXX
19488WW domain with polyproline stretch (PP2WW) of HYPBXX
19490cdN dimerXX
19491Galectin-3XX
19494HUR RRM3XX
19498bacteriophage T7 encoded inhibitor (gp1.2)XX
19499HUR RRM3XX
19500HUR RRM3XX
19502dsRBD3XX
19503WW Domain with Loop 1 ExcisedXX
19504baa38XX
19505WW Domain Strand-Swapped DimerXX
19508human wild type FAPP1-PH domainXX
19510Z-subunitXX
19511homeodomain transcription factor Gbx1XXX
19512MPER-HxB2-AAXX
19513MPER-Con089XX
19514MPER-Du151XX
19515MPER-PB7XX
19516Dot1L-AF9 complexXX
19519GS-TAMAPIN MUTATION R6AXX
19524GS-TAMAPIN MUTATION R7AXX
19527GS-TAMAPIN MUTATION R13AXX
19528DOUBLE GS-TAMAPIN MUTATION R6A R7AXX
19530BLM RQCXX
19531trimeric mutant TM domain of VEGFR2 receptorXX
19532mutant dimeric TM domain of VEGFR2 receptorXX
19533NusE (S10) from Thermotoga maritimaXX
19534non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complexXXX
19538IMS DOMAIN OF THE MITOCHONDRIAL IMPORT PROTEIN TIM21 FROM S. CEREVISIAEXX
19540MyT1 F4F5 - DNA complexXXX
19541Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39XX
19544RsmZ(SL1)/RsmE(dimer) 2:1 complexXXX
19545cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03XX
19546RsmZ(SL2)/RsmE(dimer) 2:1 complexXXX
19547RsmZ(SL3)/RsmE(dimer) 2:1 complexXXX
19548RsmZ(SL4)/RsmE(dimer) 2:1 complexXXX
19549RsmZ(36-44)/RsmE(dimer) 2:1 complexXXX
19550S1F1XX
19551hFKBP25 monomerXX
19552Blo t 19, a minor dust mite allergen from Blomia tropicalisXX
19553Blo 1 12 CBD domainXX
19554Domain 2 of E. coli ribosomal protein S1XX
19555C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11XX
19556C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1XX
19557circular g-domain analog from the wheat metallothionein Ec-1XX
19558CrcXX
19559MS1XX
19560Middle domain of Hsp90alphaXX
19561Taf-RRM-RanBPXX
19563DHFRXX
19564DHFRXX
19565DHFRXX
19566DHFRXX
19567DHFRXX
19568ISURXX
19571d(GGGTTTTGGGTGGGTTTTGGG) quadruplexXX
19572quadruplex d(TGGGTTTGGGTTGGGTTTGGG)XX
19573XANTHOMONIN IIXX
19575TubuleXX
19580PAP262-270 in SDS micellesXX
19581peptide derived from the trans-membrane region of HIV-1 gp41XX
19582peptide derived from the membrane proximal external region of HIV-1 gp41XX
19583peptide derived from the membrane proximal external region of HIV-1 gp41XX
19584Dvl-2 DEPXX
19585computational designed dimer based on the engrailed homeodomain structureXX
19586Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495XX
19590Fyn SH3 G48AXX
19591FF domain L24A mutantXX
19594G-quadruplex bound to the bisquinolinium compound Phen-DC3XX
19595oxytocinXX
19596pdx1cXX
19598WHEP repeatsXX
19599hman EPRS R12 repeatsXX
19601CXCL5XX
19604complex of calmodulin with minimal binding domain from HIV-1 matrix proteinXX
19606UBA Domain of Human NBR1XX
19608mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195XX
19609Protein-RNA Ternary ComplexXXX
19611Enzymatic cyclisation of kalata B1 using sortase AXX
19613HOP2XX
19614basic-helix-loop-helix region of the transcriptional repressor HES-1XX
19616Dimethylarginine DimethylaminohydrolaseXX
19617Big domain from Leptospira interrogansXX
19618transport proteinXX
19620DNA duplex containing N3T-ethylene-N1IXX
19621CNBHDXX
19622PetF monomerXX
19623GA-79-MBP cs-rosetta structuresXX
19625TNPXXX
19626rsahitXX
19627hypothetical protein BACUNI 03114 from Bacteroides uniformis ATCC 8492XX
19628protein NP 419126.1 from CAULOBACTER CRESCENTUSXX
19632hypothetical protein BACUNI 03114 from Bacteroides uniformis ATCC 8492XX
19634CR4/5 domain of medaka telomerase RNAXX
19638cytochrome c Y67HXX
196413rCWP7DXX
19642RBM39 RRM1XX
19654human Mcl-1XX
19657Penicillium Antifungal Protein PAFXX
19658maximin-4XX
19660pmf-gXX
19662I-V kissing-loop interaction of the Neurospora VS ribozymeXX
19663Somatostatin-14XX
19664EcDsbA-sulfonamide complexXX
19667carboxyterminal domain of NusGXX
19668a3Y monomerXX
19669Ms-NbGRP2 monomerXX
19670lysine-free (K0) ubiquitinXX
19672Dok1 PTB domain monomerXX
19674CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10XX
19675CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44XX
19677CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4XX
19678CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5XX
19679CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7XX
19681E. coli LpoBXX
19682Zinc finger-PHD-type 1 domain number-1XX
19683S-linked glycopeptide sublancin 168XX
19684HR9129AXX
19685RRM3 intermediate stateXX
19687immune signalling subunitXX
19688Tah1Pih1XX
19689SiCYSXX
19692Divalent Cations at the Active Site of the Neurospora VS RibozymeXX
19693oxidized dimeric form of human defensin 5XX
19694FHL2 LIM adaptor and its Interaction with SkiXX
19695N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAXX
19696N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAXX
19697novel venom peptide toxin from sample limited terebrid marine snailXX
19698preQ1 Class II riboswitch from Streptococcus pneumoniaeXX
19700P33A mutant of non-conventional toxin WTX from Naja kaouthiaXX
19702dimerization domain of the human polyoma, JC virus agnoproteinXX
19703Iron-sulfur cluster binding protein from Ehrlichia chaffeensisXX
19707extracellular sensor domain of DraK histidine kinaseXX
19708VSD-Q1XX
19709HR8998CXX
19710CDYL2 chromodomainXX
19711native split Npu DnaE inteinXX
19712Designed Exendin-4 analoguesXX
19713Domain-Swapped GLPGXX
19714Transport protein AXX
19715Receiver domain of ethylene receptor ETR1XX
19718Yah1 reducedXX
19719PFI1780w-PHISTXX
19720WT apo HasApXX
19721Y75A apo HasApXX
19722H83A apo HasApXX
19723Ig-alpha Ig-beta constructXX
19724Ig-alpha Ig-beta constructXX
19725Ig-alpha YE variant Ig-beta constructXX
19726GLD-1 KH-QUA2 bound to 5'-CUACUCAUAU-3'XXX
19727HIFABP Ketorolac complexXX
19730trimeric Skp with bound tOmpAXX
19731peptidyl-tRNA hyrolase from Vibrio choleraeXX
19732NLRC5 caspase recruitment domain (CARD)XX
19733trimeric SkpXX
19735TIA-1 RRM2,3 monomerXX
197361-C-Grx1XX
19737C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)XX
19739Calcium Bound S100P - V Domain of RAGE complexXX
19741p75-TM-C257AXX
19742Dimethylarginine DimethylaminohydrolaseXX
19743Pseudomonas aeruginosa Dimethylarginine DimethylaminohydrolaseXX
19744Pseudomonas aeruginosa Dimethylarginine DimethylaminohydrolaseXX
19745DNA (28-MER)XX
19746synthetic Mamba-1 peptideXX
19748Lactodifucotetraose (LDFT) beta anomerXX
19749N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1)XX
19750gp41 ectodomain monomer on a DPC micelleXX
19752LysGH15XX
19753Plectin repeat domain 6XX
19755MecAXX
19757RPAP3XX
19758RPAP3XX
19765gbvb5XX
19768hDkk4XX
19771CPEB1ZZXX
19773E81 deletion mutant from RAP80 tandem UIMsXX
19774tandem UIMs of wild-type RAP80XX
19779Solution structure of the SGTA N-terminal domainXX
19782RodAXX
19783fourth constant immunoglobulin domain of nurse shark IgNARXX
19787FKBP51XX
19788FKBP52XX
19789N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin IXX
19791Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIHXX
19792RBMXXX
19797NA,K-ATPASE REGULATORY PROTEIN FXYD2bXX
197986aJL2-R24G Amyloidogenic Light Chain ProteinXX
19799LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalisXX
19801monomer1XX
19803Anthrax Lethal Factor N-terminalXX
19806hypothetical protein ZP 02064002.1 from Bacteroides ovatus ATCC 8483XX
19807NMR structure of hypothetical protein ZP 02069618.1 from Bacteroides uniformis ATCC 8492.XX
19808GinsentideXX
19809YSCUCN in a micellar complex with SDSXX
19810BmKTX-D19KXX
19815COILED COIL DOMAIN OF Protein phosphatase 1 regulatory subunit 12AXX
19816C-domain of troponin C bound to the anchoring region of troponin IXX
19817mutation G159D in troponin C bound to the anchoring region of troponin IXX
19818metNgbXX
19819cyanometNgbXX
19821Stf76 from the Sulfolobus islandicus plasmid-virus pSSVxXX
19822B25-(alpha, beta)-dehydro-phenylalanine insulinXX
19823Lasso Peptide Caulonodin VXX
19824Solution structure of a TrkAIg2 domain construct for use in drug discoveryXX
19834New Cyt-like delta-endotoxins from Dickeya dadantii - CytC proteinXX
19835E. coli Trigger Factor in complex with unfolded PhoA220-310XX
19836E. coli Trigger Factor in complex with unfolded PhoA1-150XX
19837E. coli Trigger Factor in complex with unfolded PhoA365-471XX
19838EcDsbAXX
19839EcDsbAXX
19840ToxBXX
19841Ptr ToxBXX
19842eIF4G HEAT2 domainXX
19843ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholateXX
19845Coronavirus Envelope Proteins-1XX
19846alpha-amylase inhibitor peptide aS4 from Allatide scholarisXX
19847alpha amylase inhibitor peptide aS1 from Allatide scholarisXX
19849reduced BolA2 from Arabidopsis thalianaXX
19850GrxS14-BolA2 apo-heterodimer from Arabidopsis thalianaXX
19851Unknown protein YP 001712342.1 from Acinetobacter baumanniiXX
19853AGA modifiedXX
19859GK cecropin-like peptideXX
19860a ribosomal proteinXX
19861AGT FAPY Modified duplexXX
19862AGC FAPY modified duplex Major isomerXX
19863AG(7-deaza)G FAPY modified duplexXX
19864R1 peptideXX
19865LASSO PEPTIDE BASED INTEGRIN INHIBITOR: MICROCIN J25 VARIANT WITH RGDF SUBSTITUTION OF GLY12-ILE13-GLY14-THR15XX
19869ZapA homodimerXX
198706aJL2 Amyloidogenic Light Chain ProteinXX
19876YmoB. A modulator of biofilm formationXX
19881transport protein mXX
19884CcPXX
19885SENP1XX
19887Oligonucleotide Model of the MiR-21 Pre-ElementXX
19893Q4D059, a hypothetical protein from Trypanosoma cruziXX
19901Thymosin alpha 1XX
19902P15 FLiPSXX
19904PPIase domain of TbPar42XX
19905phosphorylated 4E-BP2 monomerXX
19907L7Ae apoXX
19908L7Ae RNA complexXXX
19910P22S mutant of N-terminal CS domain of human Shq1XX
19915cold shock protein, TaCspXX
19916cold shock protein, TaCsp with dT7XX
19921hIFABP-oleate complexXX
19922TDP-43 RRM2XX
19930p38-0P apoXX
19931DC-SIGNXX
19934p38 2P apoXX
19935Dual-phosphorylated human p38 alpha ADP-boundXX
19936Dual-phosphorylated human p38 alpha MK2 334/D peptide boundXX
19937Dual-phosphorylated human p38 alpha ADP and MK2 334/D peptide boundXX
19938putative thioredoxin (ECH 0218) in the oxidized stateXX
19940ompaXX
19941TM domain of LAMP-2AXX
19942terminal Ig-like domain from Leptospira interrogans LigBXX
19943inner membrane protein YgaPXX
19946cytoplasmic rhodanese domain of the full-length inner membrane protein YgaPXX
19947Bitistatin AXX
19948S38-S107 peptide of 18.5 kDa MBPXX
19949MBP S38-S107 peptide in the presence of Fyn-SH3XX
19953V domain of RAGE in complex with IORXX
19955tandem SH3 domain of CAPXX
19960Human Chemokine CCL19XX
19962Truncated L126Z-sod1XX
19963Bitistatin BXX
19970Enterocin NKR-5-3BXX
19972MBP S72-S107 peptide in the presence of Fyn-SH3XX
19973potent antifungal peptide Cm-p5XX
19974BA42 proteinXX
19976BlaP197XX
19978[AibB8,LysB28,ProB29]-insulin analogueXX
19980CnA freeXX
19981CnA-VIVITXX
19982NPM-N (Nucleophosmin) pentamerXX
19986Xenopus RecQ4 zinc knuckleXX
19989N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1XX
19990ShKXX
19993LysRS1-72XX
19994protein YgaP from Escherichia coliXX
19995LysRS Anticodon Binding Domain 72-207XX
19996ROQ-TnfXXX
19999osteopontin monomerXX
20009CLN025XX
20010model peptide for INPXX
20011CLN025XX
20014CAPISTRUINXX
20022metastin analogXX
20024TIIIAXX
20025SIIIAXX
20026F proteinXX
20027brome mosaic virus protein 1aXX
20029Apelin 17XX
20030Apelin 17XX
20031Apelin 17XX
20033dicarba-ImIXX
200344FXX
20036Cyclic PseudotetrapeptideXX
20037Cyclic PseudotetrapeptideXX
20038Cyclic PseudotetrapeptideXX
20039Cyclic PseudotetrapeptideXX
20040Cyclic PseudotetrapeptideXX
20041Cyclic PseudotetrapeptideXX
20042Cyclic PseudotetrapeptideXX
20043Cyclic PseudotetrapeptideXX
20044Interleukin-8 C-terminal domainXX
20047fusionpeptideXX
20050D-PAKKR monomerXX
20054KIA7W tetramerXX
20055KIA7H tetramerXX
20056LSEAL-CaMLD complexXX
20057YI12WFXX
20058YI12WWXX
20059YI12WYXX
20060YI12FFXX
20061GG8WFXX
20062Myelin Basic ProteinXX
20063Model PeptideXX
20075MeuTXKbeta1XX
20076TC6bXX
20078HEDISTINXX
20079rhodopsin-jue11-complexXX
20080hCGA(G364S)XX
20081complex BK-PGGXX
20085SFT-L1XX
20086nociceptin AntagonistXX
20087nociceptin analogueXX
20088nociceptin analogueXX
20089nociceptin analogueXX
20090KAAADXX
20091rsv analogueXX
20092cspXX
20093REV analogueXX
20094trans Pis-1[NkG]XX
20095cis Pis-1[NkG]XX
20098Pis-1 [PG]XX
20101Substance PXX
20102t11XX
20104xt-7XX
2010915-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)XX
20112Gaq-ct onlyXX
20113Temporin-SHfXX
20115Substance PXX
20116Substance P in DMPC/CHAPS bicellesXX
20117Substance P in DMPC/CHAPS/GM1 bicellesXX
20118C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptorXX
20119thromboxane A2 receptorXX
20121tubulysinXX
20122CCAP-vilXX
20123NS4A(1-22)XX
20124[113-122]ApoJXX
20125VK22 in DPC micellesXX
20126Alpha-conotoxin Vc1.2XX
20127nociceptin AgonistXX
21000MccJ25 RGDXX
21002Tryptophan Zipper analogueXX
21008TemporinLXX
21009upain-1XX
21010extended upainXX
21011PROTEINXX
21013RI23XX
21014conotoxin lt14aXX
21015conotoxin pu14aXX
21031Lewis aXX
21032SUGAR (3-MER)XX
21033Lewisx-FimHXXX
21034Lewisx methyl glycosideXX
21035PROTEINXX
21036AIP-III D4A peptideXX
21037AIP-III DF5XX
21038AIP-III DL7 peptideXX
21039AIP-III F5A peptideXX
21040AIP-III L7A peptideXX
21041tAIP-IIIXX
21042tAIP-III D2AXX
21045PROTEINXX
21046AIP-II peptideXX
21047AIP-IV peptideXX
21053LDNF (trisaccharide)XX
21054Bv9(trisaccharide)XX
21056SFTI-TCTR N12 N14 NMeSer6XX
21057SFTI-TCTR N12 N14XX
21058Papiliocin(1-8)-MAGAININ 2(4-12) HYBRID PEPTIDE ANALOGUEXX
21059trans-PapMA-kXX
21062conotoxin Im10AXX
21074B3MPXX
21075BLACAXX
21076BLACBXX
21077BLACCXX
21078BLACDXX
25000WW3 domain of Nedd4L in complex with its HECT domain PY motifXX
25003BlaP216Q0XX
25005CAP-GLY DOMAINXX
25009Cysteine Deleted Protegrin-1 (CDP-1): rr14XX
25011Cysteine Deleted Protegrin-1 (CDP-1): rr11XX
25012Cysteine Deleted Protegrin-1 (CDP-1): lr10XX
25013YqcAXX
25014holo YqcAXX
25015holo FldAXX
25016Y125F mutant of eRF1 N-domainXX
25018OR414XX
25019DHFR-folateXX
25020E55Q mutant of eRF1 N-domainXX
25021ROQ domainXX
25022Polyglutamine binding peptide 1 (QBP1)XX
25023Drosophila ELF domain from FANCLXX
25026NMR structure of putative beta-lactamase (NP 372339.1) from Staphylococcus aureus Mu50XX
25027NMR structure of the hypothetical protein BVU 0925 from Bacteroides vulgatus ATCC 8482XX
25028NMR structure of the hypotheical protein Lreu 0056 from Lactobacillus reuteriXX
25029hGHXX
25030OMPA C-terminal domainXX
25032bacterial immunoglobulin-like domain form a surface protein of LeptospiraXX
25034cChimera Ca2+ boundXX
25035cChimeraX Ca2+ boundXX
25036CsUblXX
25037N terminal domain of the MuB AAA+ ATPaseXX
25038hnRNP LXX
25039Second RNA Recognition Motif Domain of hnRNP LXX
25040most two C-terminal RNA Recognition Motif Domain of hnRNP LXX
25041First RNA Recognition Motif Domain of hnRNP L bound to CACACA RNAXXX
25042Second RNA Recognition Motif Domain of hnRNP L bound to ACACAC RNAXXX
25043Most two C-terminal RNA Recognition Motif Domain of hnRNP L bound to two equivalents ACACA RNAXXX
25046DC-SIGNR CRD apoXX
25047RRM-PEPTIDE and RES COMPLEXXX
25049RNA (68-MER)XX
25052Nucleocapsid protein p10 and RNA (68-MER)XXX
25059dCSD1XX
25060dCDS1-RNAXXX
25061Structure of De novo designed Protein OR457XX
25062OR462XX
25064PCP7TXX
25065PCP7T holo formXX
25067NESG Target OR459XX
25068High mobility group protein from Plasmodium falciparum 3D7XX
25069human Ca2+-loaded S100A4 cys-free mutantXX
25070Rad18-UBZ/ubiquitin complexXX
25071Rad18-UBZXX
25072SXL-UNR-msl2-mRNAXXX
25077PTPN4 PDZ-linkerXX
25078CSD1-SXL-18-mer msl2 mRNAXX
25079human EpoRXX
25081Fyn SH2 boundXX
25082Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptideXX
25083Putative uncharacterized protein BTH I2711XX
25084Cdc5-D3 monomerXX
25085rhodanese domain of YgaPXX
25086truncated EcMazEXX
25092MazE-DNA bindingXXX
25093EcMazE homodimerXX
25094EcMazE homodimerXX
25096MciZ from Bacillus subtilisXX
25098copper binding protein in the apo formXX
25099Hs2 dimerXX
25100pf tRNApro:MLV-Nucleocapsid (1:2) ComplexXXX
25101tRNApro:MLV Nucleocapsid Protein (1:1) ComplexXXX
25106CAG RNAXX
25109MAVS CARDXX
25110left-handed G-quadruplexXX
25118cTnI[1-73]XX
25119cTnI[1-73]-cTnCXX
25120cTnC-cTnI[1-73]-cTnI[144-163]XX
25122SCORPION VENOM TOXIN Ts11 (TsPep1) FROM TityXX
25124BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35CXX
25125Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35CXX
25130LEDGF/p75 IBD in complex with MLL1 peptide (140-160)XX
25131Kindlin-2 F2XX
25132VEEV macro domainXX
25134AMA1-R1XX
25135MLKL N-terminal domainXX
25136S100A4dCXX
25137EL LovRXX
25139MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1XX
25141EL LovRXX
25142Hox homeodomainXX
25143RING finger of the tripartite 19XX
25145B1 box monomer of the tripartite 19XX
25146httNTQ30P10K2 fibrilsXX
25147DNA binding domain of sigma 54 from E.coliXX
25149Isolated Ring domainXX
25150human ubiquitin conjugating enzyme Ube2wXX
25152MTAbl13, a grafted MCoTI-IIXX
25153holo FldBXX
25154DMXAA-bound mSTING dimerXX
25155apo FldBXX
25156Decorin Binding Protein AXX
25157Decorin Binding Protein AXX
25158Doc48S monomerXX
25161CrnA1'XX
25162CrnA2'XX
25163three-way junction from the VS ribozymeXX
25164three-way junction from the VS ribozymeXX
25165OR109XX
25167Human Shq1 CS domainXX
25168flpp3Sol 2XX
25172Ca-bound hN-1 4-7XX
25175NisIXX
25177De Novo Designed Peptide that Sequesters Toxic Heavy MetalsXX
25179wtNS4AXX
25180mutNS4AXX
25188YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNAXXX
25193NisIXX
25194NisIXX
25195putative arsenate reductase from Brucella melitensisXX
25196haloSRCXX
25199myrGCAP2XX
25203Peptide of acidic-basic repeat antigen (ABRA) from Plasmodium falciparumXX
25208S100A4dC-MPT complexXX
25209synthetic peptide 36075XX
25218amyloid betaXX
25219UBM1 domain of human HUWE1/ARF-BP1XX
25221PHD domain of Yeast YNG2XX
25224human IgG-FcXX
25225trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)XX
25226cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)XX
25227aSyn WT monomerXX
25228aSyn H50Q monomerXX
25229Human FAAP20 UBZXX
25230Human FAAP20 UBZ-Ubiquitin ComplexXX
2523114-3-3 ZetaXX
25232F231L mutant ERCC1-XPF dimerization regionXX
25233S31N 19-49XX
25234M2 19-49XX
25237MBPXX
25238Human Relaxin-2XX
25239La-RRM1XX
25240Twinstar from Drosophila melanogastorXX
25242Sk45mNoTagXX
25243Arsenate ReductaseXX
25244HuR RRM1 monomerXX
25247FliFc-FliG complexXX
25250PrPdelta190-197XX
25251PrPdelta193-196XX
25253Y99E,N111D CAM-iNOSXX
25257Y99E CAM-eNOSXX
25259hypothetical protein NP 344732.1 from Streptococcus pneumoniae TIGR4XX
25260human insulinXX
25261[GlnB22]-insulin mutantXX
25263CUS-3idXX
25265Uncharacterized proteinXX
25266decorin binding protein BXX
25267TRIM25 (PRYSPRY) domainXX
25269ASM1XX
25275eEF1Bdelta CAR domainXX
25276eEF1Bdelta CAR domain in TCTP-bound stateXX
25278RisSXX
25280mouse BMAL1 transactivation domainXX
25281YERSINIA PESTIS AIL (ATTACHMENT INVASION LOCUS)XX
25282MJ0366XX
25283scoloptoxin SSD609 from Scolopendra mutilansXX
25288TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)XX
25289amyloid-beta fibrils: the Osaka mutationXX
25293Kalata B7 Ser mutantXX
25294NP 809137.1 monomerXX
25298Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor proteinXX
25299Human Small Ubiquitin like Modifier protein-1 (SUMO-1)XX
25301OBSC-Ig1XX
25302Monomer of Mo3964XX
25303titin M10-obscurin-Ig1XX
25304obscurin Ig1 bound to titin M10XX
25305titin M10XX
25307SATB1 homeodomainXX
25308obscurin Ig58XX
25309FBP28 WW2 , mutation Y438RXX
25310FBP28 WW2 mutant Y446LXX
25311FBP28 WW2 mutant W457FXX
25312MBD1 CXXC1XX
25313FBP28 WW2 mutant Y438R DNDCXX
25314FBP28 WW2 mutant Y438R L453A DNDCXX
25315FBP28 WW2 mutant Y438R DNXX
25317ACE-GLY-ASP-GLY-NH2 peptideXX
25318ACE-GLY-GLU-GLY-NH2 peptideXX
25319ACE-GLY-HIS-GLY-NH2 peptideXX
25320ACE-GLY-CYS-GLY-NH2 peptideXX
25321ACE-GLY-TYR-GLY-NH2 peptideXX
25322ACE-GLY-LYS-GLY-NH2 peptideXX
25326carboxy-terminal domain of DNTTIP1XX
25328HUA2XX
25329HUB2XX
25330HUABXX
25334Type 1 PilusXX
25342NMR structure of the protein YP 193882.1 from Lactobacillus acidophilus NCFM in presence of FMNXX
25343Talin-F3 / RIAM N-terminal Peptide complexXX
25344CaM Tr2C, monomerXX
25345PfCDPK3 CLD(B)XX
25346MG200 EAGRboxXX
2534753BP1 tandem Tudor domains in complex with a p53K370me2 peptideXX
2534853BP1 tandem Tudor domains in complex with a p53K382me2 peptideXX
25349WW3XX
25350PsbQ from spinacia oleraceaXX
25351RING finger monomerXX
25352Acidocin BXX
25354Abp1p SH3 domainXX
25355EphB2 kinase domainXX
25356TPMT *1 16-245XX
25358periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factorXX
25359BamAXX
25363crotalicidin in DPC micellesXX
25364SLBP/RNAXXX
25365SLBPXX
25366crotalicidin-NtXX
25368EF-GC3 monomerXX
25370Crotalicidin-CtXX
25372CG KIXXX
25375PTP1B CPT-157633 ComplexXX
25376RING Domain of human Promyelocytic Leukemia Protein (PML)XX
25377MDMX-P53XX
25378A G-quadruplex structureXX
25379PsbPXX
25382UBX-L domain of VCIP135XX
25383human TRAP1-NTDXX
25385Ssa1 substrate binding domainXX
25386zinc finger domainXX
25387bpsl1445XX
25391tumor protein monomerXX
25393IST1 peptideXX
25395internal EH domain of gamma-synerginXX
25396mouse EpoRXX
25400lcFABPXX
25401CCL28XX
25403Clathrin Heavy ChainXX
25406H56PXX
25408VG16KRKP, an antimicrobial peptide in D8PG micellesXX
25409VG16KRKP, an antimicrobial peptide in SDSXX
25416RNA (39-MER), 3' splice site in influenza A: 39-nt hairpinXX
25417CadC1-159XX
25424DEFA1, a highly potent antimicrobial peptide from the horseXX
25425transforming growth factor beta induced protein (TGFBIp)XX
25426MBD2 IDRXX
25428acidic domain of SYNCRIP (hnRNPQ)XX
25430GADD34 PP1 complexXX
25432TOGXX
25433RBM10 ZnF1XX
25434OCREXX
25435Amylase binding Protein AXX
25436hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNAXXX
25437Endo T5-ZN+2XX
25441VP8XX
25442Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Bud13p(215-255XX
25443Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Pml1p(22-42)XX
25448N-terminal domain of human TIG3XX
25449RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparumXX
25451dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei bruceiXX
25452Omega-Tbo-IT1 Selective Inhibitor of Insect Calcium ChannelsXX
25455cytochrome OmcFXX
25456Cullin3 - BTB interfaceXX
25457Cullin3 - BTB interfaceXX
25459Fungus protein Q8J180 MAGGRXX
25460Fungus protein B9WZW9 MAGORXX
25461CUE domain of yeast Cue1XX
25462NS1B ED mutant monomerXX
25463NS1B ED dimerXX
25464MbtH-like protein from Mycobacterium marinumXX
25465ConRlBNQOXX
25467GB1-PLAT (PKD1 PLAT)XX
25468PDFL2.1XX
25469hnRNP C RRM in complex with 5'-UUUUC-3' RNAXXX
25475Tau(267-312) bound to MicrotubulesXX
25481perforin C2 quad mutantXX
25482GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY)XX
25484p300 Taz2-p53 TAD2 ComplexXX
25485PRO Form of Human Matrilysin (proMMP-7)XX
25486Purotoxin-2 in waterXX
25487Purotoxin-2 in DPC micellesXX
25488PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic MembraneXX
25489PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic MembraneXX
25490Conantokin Rl-BXX
25491Conantokin Rl-BXX
25494First and Second KH domains of hnRNP E1XX
25495cNTnC-cTnIA162HXX
25496RRM3 domain of Gbp2XX
25497RRM1 domain of Hrb1XX
25498RRM2 domain of Hrb1XX
25499RRM3 domain of Hrb1XX
25500SH2-SH3 adapter protein drkXX
25501SH2-SH3 adapter protein drkXX
25506Re-SDPhe-TATE isomer 1XX
25507Linear SDPhe-TATEXX
25508Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710bXX
25509APOBEC3G NTD variant, sNTDXX
25510AIM2 PYD from Mus musculusXX
25511cChimeraX-A162H, Ca2+ boundXX
25513TSPO A147T variant in complex with PK11195XX
25514phosphorylated J-domain of Human Cysteine String Protein (CSP)XX
25515non-phosphorylated J-domain of Human Cysteine String Protein (CSP)XX
25516Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1XX
25517Short hydrophobic peptide, 11merXX
25518Alpha-SynucleinXX
25527alpha-crystallin domain from human, HSPB5XX
25529hylin a1XX
25530AQ1974XX
25533Ca-bound hN-1 8-11XX
25535alpha-synuclein fibrilsXX
25536MDMX-057XX
25538Mdmx-SJ212XX
25540NSsCT-Tfb1PH complexXX
25541MyUb (1080-1122) of human Myosin VIXX
25542MyUb (1080-1131) of human Myosin VIXX
25543human Myosin VI isoform3 (998-1071)XX
25544human Myosin VI isoform3 (1050-1131)XX
25545MyUb (1080-1122) of human Myosin VI with K63-diUbXX
25546MDMX-295XX
25548DHX36XX
25549mBMAL2-TADXX
25551Covalent, disulfide crosslink of V197C/C128A yeast cytochrome c peroxidase and A81C/C102T yeast iso-1 cytochrome cXX
25552PLK4-PB3 monomerXX
25554nucleotide-free Ran GTPaseXX
25555PvHCtXX
25556MRG15-MRGBP complexXX
25557PrxQXX
25560MRH-GIIbXX
25565BCOR PUFDXX
25566PrxQXX
25567YP 193882.1XX
25569PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptideXX
25570ns5bcXX
25572Dad2XX
25576human SUMO1XX
25577human SUMO2XX
25582Protein and DNA complexXXX
25584complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)XX
25586wt NS4A N-terminal domain of DENVXX
25588High-affinity calmodulin complexes with vanilloid ligands of TRPV1XX
25590Fag s 1XX
25593HER2/ErbB2 dimeric transmembrane domainXX
25596G-quadruplexXX
25597Dynorphin 1-13 bound to Kappa Opioid ReceptorXX
25599Sds3 in complex with Sin3AXX
25600LigA4 Big domainXX
25601closed state of Lys63-linked diubiquitinXX
25602GATXX
25605HsAFP1XX
25606AR-4QXX
25607AR-25QXX
25609RsAFP2XX
25610pheromone Ep-1 from Euplotes petziXX
25611OR303XX
25612OR358XX
25613[B26-B29 triazole cross-linked]-insulin analogueXX
25614insulin analogueXX
25615insulin analogueXX
25627meiosis-expressed gene 1 (Meig1)XX
25628KinaseXX
25629KinaseXX
25631ace-pvhct-nh2XX
25632TBD 1-22XX
25634ABD monomerXX
25636AVR-Pia monomerXX
25638C-terminal domain of the chromodomain helicase DNA-binding protein 1XX
25639LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)XX
25640INTERACTION OF CYTOCHROME C AND CARDIOLIPINXX
25642cytoskeletal bactofilin BacAXX
25645HSPB1 ACDXX
25646p75-TMICD/LPNXX
25647p75-TMDCD/DPCXX
25648p75-TMDCD/LPNXX
25649Human Brd4 ET domain in complex with MLV Integrase C-termXX
25650RNA recognition motif-1 of serine/arginine-rich protein 1XX
25651active G-quadruplex motif from AGRO100XX
25652PTBRRM1-SL23H complexXXX
25653ASTEROPSIN GXX
25654II-III-VI three-way junction from the VS ribozymeXX
25655II-III-VI three-way junction from the VS ribozyme in complex with MAGNESIUMXX
25657Proteasome protein fragmentXX
25659TDP-43 Amyloidogenic Core RegionXX
25660Y48pCMF variant of human cytochrome c in its reduced stateXX
25662or446XX
25664NESG Target OR34XX
25666or34XX
25667G335D Mutant of TDP-43 Amyloidogenic Core RegionXX
25668Q343R Mutant of TDP-43 Amyloidogenic Core RegionXX
25670Enterocin HFXX
25671HIV ISS elementXX
256733-stranded parallel beta-sheetXX
25674MALT1 subunit 1XX
25675N-TERMINAL DOMAIN OF TDP-43XX
25676NS4A mutXX
25677CBX8 in complex with AF9XX
25678L453DXX
25679L453EXX
25680L453WXX
25681E454YXX
25682T456DXX
25683T456YXX
25684LIPID DROPLET ANCHORING PEPTIDE OF CGI-58XX
25686G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genomeXX
25688Acyl Carrier Protein monomerXX
25690eukaryotic elongation factor 1B monomerXX
25692OVIS ARIES PRPXX
25693xcL1XX
25694CXCL12-CXCR4XX
25702reduced form of thioredoxin 1 from Sacharomyces cerevisiaeXX
25703oxidized form of thioredoxin 1 from Sacharomyces cerevisiaeXX
25704lasso peptide chaxapeptinXX
25705N-NTDXX
25706VirA VirFG fusionXX
25707Ub in complex with parkin R0RBRXX
25708Ub S65EXX
25709Ub S65E in complex with parkin R0RBRXX
25710high-density lipoprotein particlesXX
25711HLA-B2705 TISXX
25712dehydroascorbate reductase 3A from Populus trichocarpaXX
25713HLA-B2709 pVIPRXX
25714HLA-B2705 pVIPRXX
25715HLA-B2709 TISXX
25716pyoluteorin type II pep-tidyl carrier protein PltL, holo formXX
25717PltL-pyrrolylXX
25718Regnase-1 N-terminal domainXX
25719Regnase-1 Zinc finger domainXX
25720Regnase-1 C-terminal domainXX
25721VirA DDXX
25722KIAA0323 binding preference for NEDD8XX
25725cystein-rich peptide jS1XX
25728HBPd24rXX
25729EGFR transmembrane and juxtamembrane domainsXX
25730H-Ras G12VXX
25732PetPXX
25738Re-SDPhe-TATE isomer 2XX
25739Re-SDPhe-TATE isomer 4XX
25740C-terminal domain of Cdc37 cochaperoneXX
25744RpfCXX
25745N-terminal domain of the metalloprotease PrtV from Vibrio choleraeXX
25746DNA G-quadruplexXX
25748ddFLN5+110XX
25750CIN85 CC-domain trimerXX
25751VG16KRKP DIMERXX
25753sweeter mutant (D40K) of sweet protein BrazzeinXX
25755non-sweet mutant (ins18RI19) of sweet protein BrazzeinXX
25757calmodulin-connexin36XX
25758de-novo toxin Hui1XX
25759Quercetin complexed with c-myc G-quadruplex DNAXX
25760GNPTABXX
25761PC07372DXX
25762PleiotrophinXX
25763MbtH-like protein from Mycobacterium aviumXX
257642-stranded parallel beta-sheetXX
257652-stranded parallel beta-sheetXX
25767Vta1NTD-Did2(176-204) complexXX
25768Outer Membrane Protein G from Pseudomonas aeruginosaXX
25769frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2]XX
25770N Est2XX
25773Trappin-2XX
25774spider toxin, U4-agatoxin-Ao1aXX
25776Outer Membrane Protein G P92A mutantXX
25777Tetrahymena telomerase RNA pseudoknotXX
25778spider toxin U4-hexatoxin-Hi1aXX
25779RRM2 monomerXX
25786holo ArCP from yersiniabactin synthetaseXX
25787salicylate-loaded ArCP from yersiniabactin synthetaseXX
25788Influenza-A M2XX
25789CmPI-II, a serin protease inhibitorXX
25790polyQ regulatory proteinXX
25791kinase in complex with its regulatory proteinXX
25794NESG Target OR446XX
25796complex of PEP-19 bound to the C-domain of apo calmodulinXX
25797cardiac troponin CXX
25798human Siglec-8XX
25799human I-type lectin domain-glycan complexXXX
25800Plasmodium falciparum SR1-RRM1 in complex with ACAUCA RNAXXX
25801UBL domain of the human DNA damage-inducible protein homolog 2XX
25802CD302XX
25803UBL domain of the yeast DNA damage-inducible protein homolog 1XX
25805cyclic nucleotide-binding homology domain of hERG channelXX
25806prolactin receptor transmembrane domainXX
25807B3 domain of protein GXX
25808KIAA0323 binding with NEDD8XX
25809W60G beta2-microglobulinXX
25810N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9XX
25811core of the U4/U6 di-snRNAXX
25813Peptide PG-989XX
25814Peptide PG-990 in DPC micellesXX
25817transmembrane domain of human nicastrin in SDS micellesXX
25818transmembrane domain of human nicastrin in DPC micellesXX
25820Peptide PG-990XX
25821BlaPdPGXX
25825UBL proteinXX
25826microRNA 20b pre-elementXX
25827metal-binding domain 1 of ATP7BXX
25828RIP2 CARDXX
25829p75NTR DD:RhoGDIXX
25831complex of microRNA 20b pre-element with Rbfox RRMXXX
25832CPR3XX
25833p75NTR DD:RIP2 CARDXX
25834FHA domain of TbPar42XX
25835OtTx1a - AMP in DPC micellesXX
25836OtTx1a - ICKXX
25837chromodomain 3 (CD3) of cpSRP43XX
25838A3CT monomerXX
25839YgaUXX
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dCXX
25847cyclic PVIIAXX
25848spider toxin pi-hexatoxin-Hi1aXX
25849Gbx1[E17R,R52E]XX
25850DA05XX
25852CaM-eNOSXX
25853spider toxin, U33-theraphotoxin-Cg1cXX
25856translation initiation factor from Staphylococcus aureus Mu50XX
25857Aureocin A53XX
25858Lacticin QXX
25859complex between MMP-12 and synthetic triple-helical collagenXX
25860DHFRXX
25861DHFR-NXX
25863ACT RTX domainXX
25867PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRESXX
25868DA05R1XX
25869LptEXX
25872TrkA transmembrane domainXX
25873RSK1 peptideXX
25877cecropin P1 with LPSXX
25881yeast Hit1 protein zinc fingerXX
25883DD homodimerXX
25886acyl carrier protein LipDXX
25887SLURP-2, a secreted isoform of Lynx1XX
25898Decoralin-NH2XX
25899RockCCXX
25900NRAS Isoform 5XX
25902actinin-1 EF bound to IQXX