Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.


Number of entries returned: 7982

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameIUPAC CS referencingProteinDNARNAOther
246growth factorXX
614neurotoxin IIIXX
1175phosphoglycerate kinaseXX
1176phosphoglycerate kinaseXX
1177phosphoglycerate kinaseXX
1486copper-zinc superoxide dismutaseXX
1487copper-zinc superoxide dismutaseXX
1844phosphoglycerate kinaseXX
1845phosphoglycerate kinaseXX
1846phosphoglycerate kinaseXX
2265subtilisin inhibitorXX
3065cro repressorXX
3433Src tyrosine kinaseXX
4052staphylococcal nucleaseXX
4053staphylococcal nucleaseXX
4065designed four-alpha-helix bundle proteinXX
4068turkey ovomucoid third domainXX
4072RNA-1 Modulator ProteinXX
4089peptide deformylaseXX
4097RNase H domain of HIV-1 RVT strain BH10XX
410314mer DNA duplex containing the operator sequence BS2XX
4104BS2 operator DNA complexed with the Antennapedia HomeodomainXXX
4109rat CD2 domain 1XX
4126single chain three helix bundleXX
4133Tropomyosin GCN4 chimeraXX
4140EH1 domain of mouse Eps15XX
4141vnd/NK-2 homeodomain DNA complexXXX
4145Tec Src Homology 3 (SH3) domainXX
4150third extracellular N-terminal domain of gp130XX
4151F1FO ATP Synthase Subunit cXX
4153Retinoid-X-Receptor -alpha DNA Binding domainXX
4154oxidized putidaredoxinXX
4156Protein Disulfide IsomeraseXX
4159Long Neurotoxin 1 (Component LSIII)XX
4160Tn916 integrase subunit 1XX
4161IRF-2 DNA binding domainXX
4163Aesculus hippocastanum Antimicrobial Protein 1XX
4164pyoverdin G4RXX
4165Tn916 integrase DNA complexXXX
4166C2A domain of synaptotagmin IXX
4167C2A domain of synaptotagmin IXX
4169pyoverdin G4RXX
4177Monocyte chemoattractant protein-3XX
4183DtxR subunit 3, C-terminal domainXX
4188C2 Domain of Cytosolic Phospholipase A2XX
4189cytochrome cXX
4194D-Pro melittinXX
4195Alpha-Bungaratoxin/Library Peptide ComplexXX
4200c-Myc-Max Heterodimeric Leucine ZipperXX
4212synthetic L-peptide corresponding the the G-H loop of the foot-and-mouth disease virus VP1 proteinXX
4219eel calcitoninXX
4223TATA box binding protein associated factor II 230XX
4225Glutaredoxin 3 systemXX
4229Fe8S8 FdXX
4232Calcium binding subunit of troponin, TnC monomerXX
4237MinE topological specificity domainXX
4242Major Sperm ProteinXX
4248Lymphoid enhancer-binding factorXXX
4251Src homology domain 3 and 2XX
4252Abl SH(32) complexXX
4253T2 RNA PseudoknotXX
4260GlcNAc eel calcitoninXX
4261M6 eel calcitoninXX
4264Phosphotransferase system, enzyme IXX
42687-Fe FerredoxinXX
4269gamma delta resolvase catalytic coreXX
4279Centruroides sculpturatus Ewing Toxin IXX
4282XRCC1 N-terminal domainXX
4284Calmodulin-Ca2+-Pump-Peptide ComplexXX
4285S100A dimerXX
4291Cytochrome C3XX
4295Titin type I domainXX
4296Major cold shock protein from E. coliXX
4298V3 loop peptide of RF HIV-1 gp120 envelope proteinXX
4301Pathogenesis-related Protein P14aXX
4302protein disulfide isomerase a' domainXX
4304neuronal nitric oxide synthase PDZ domain complexed with a peptideXX
4305protein inhibitor of neuronal nitric oxide synthaseXX
4307Recombinant Syrian hamster prion proteinXX
4308cytokine receptor common beta chain domain 4XX
4310calmodulin:SL3 Enhancer Factor2-1 complexXX
4311human T-cell leukemia virus type I capsid monomerXX
4314HCC-2 chemokineXX
4315Iron-containing superoxide dismutaseXX
4316subunit c of ATP synthaseXX
4317NS1(1-73) dimerXX
4318glutaredoxin 2XX
4319Oxidized RubredoxinXX
4320Reduced RubredoxinXX
4321p55 monomer in complex with CoAXX
4322consensus V3 loop peptideXX
4326N-Terminal Domain of DNA Polymerase BXX
4327N-terminal inhibitory domain of human tissue inhibitor of metalloproteinases-1XX
4328N-terminal domain of HsRad51XX
4329E.coli Transhydrogenase domain IIIXX
4331Streptomyces subtilisin inhibitorXX
4333FADD death domainXX
4340major urinary proteinXX
4341Iron-containing superoxide dismutaseXX
4349Fv fragment of the catalytic antibody NPN43C9XX
4353p13 c-terminal domainXX
4355tetramerization domain of the Mnt repressorXX
4365stromelysin-ligand complexesXX
4366stromelysin-ligand complexesXX
4368A35T vnd/NK2 mutant homeodomainXXX
4371Recombinant Onconase/P30 proteinXX
4379human prion protein fragment 121-230XX
4381Third EH domain of human Eps15XX
4383wheat ns-LTPXX
4385elongation factor-1betaXX
4388Cyclic AMP Receptor Protein dimerXX
4389Ribosome Recycling FactorXX
4390CC-chemokine eotaxinXX
4392DNA minor groove binderXX
4396Nematode Anticoagulant Protein c2XX
4400H-y5 Triple HelixXX
4401skeletal N-troponin CXX
4402human prion protein hPrP(23-230)XX
4403Polyomavirus J domainXX
4408contryphan-R (minor form)XX
4411transforming growth factor beta3XX
4417Major Pollen Allergen Bet v 1-LXX
4418cytotoxin 2, minor formXX
4419cytotoxin 2, major formXX
4421PhoB DNA-binding domainXX
4427toxin 7XX
4429ribosomal protein L7 from E. coliXX
4432glycine receptor alpha 1 subunit TM2 segmentXX
4433glycine receptor alpha 1 subunit TM2 segment S267YXX
4434Human prion protein fragment 90-230XX
4438Sterol carrier protein 2SeeXX
4439Human Ferredoxin oxidizedXX
4440Human Ferredoxin reducedXX
4441Anabaena 7120 vegetative FerredoxinXX
4442Anabaena 7120 vegetative FerredoxinXX
4445HRDC domainXX
4448Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolaseXX
4449antifreeze protein type III intramolecular dimer RD3XX
4451N-terminal domain of caspase-activated DNaseXX
4452sea raven Type II antifreeze proteinXX
4453alpha-actinin/titin complexXX
4454alpha-actinin/titin complexXX
4455CD58 adhesion domain, 1dCD58XX
4456aIIb cytoplasmic domainXX
4461Cycloviolacin O1XX
4463Ras-binding domain of Byr2XX
4465His117Gly azurinXX
4467chicken MeCP2/ARBP monomerXX
4471cytochrome c552XX
4472BeFx-activated CheY from E. coliXX
4473Camp dependent protein kinase type ii regulatory chainXX
4493Ubiquitin core mutant 1D7XX
4506type IIA bacteriocin carnobacteriocin B2XX
4524Endoglucanase SS dockerin domainXX
4554Dihydrofolate reductase complex with NADPH cofactorXX
4557herpes simplex virus protein ICP47XX
4558YopH-NT monomerXX
4563Bovine prion protein fragment 121-230XX
4564Bovine prion protein fragment 23-230XX
4566bovine adrenodoxinXX
4567catalytic domain of yUBC1XX
4572PBX homeodomainXX
4575N-terminal 24 kDa fragment of gyrase BXX
4576a3T3 hybridXX
4632Pro-Apoptotic Protein BAXXX
4634Multifunctional aminoacyl-tRNA synthetase(E.C.
4639human Rap1XX
4661Apoptotic protease activating factor 1XX
4663protein (1D8 UBIQUITIN) mutant (I3L,I13L,L15V,V17L,I23V,V26L,I61L,L67I)XX
4664lipocalin Q83XX
4666transcarboxylase 1.3S subunitXX
4668FK506 binding protein from Methanococcus thermolithotrophicusXX
4673ileal lipid binding proteinXX
4680C-terminal domain of MLTDXX
4697fMet-tRNA binding domain of initiation factor IF2XX
4702C-terminal negative regulatory domain of p53 in complex with Ca2+ -bound S100B(bb)XX
4717C-terminal FtsZ binding domain of E. coli ZipAXX
4718replication terminator proteinXX
4719Ras binding domain of rat AF6XX
4720Inhibitor-2 monomerXX
4721general transcription factor TFIIE-BETAXX
4728EGF 3 module from human vitamin K-dependent protein SXX
4729EGF-like module pair 3-4 from human vitamin K-dependent protein SXX
4735olfactory marker proteinXX
4738Cu(II) Plastocyanin from Anabaena variabilisXX
4739Calcium Vector ProteinXX
4740MTH1184 monomerXX
4744cytochrome c7XX
4751mouse lysozymeXX
4770Cell Division Control Protein 42 from Candida albicansXX
4777cytochrome c552XX
4781SL2 stem loop RNA from HIV-1XXX
4788Reps1 EH domainXX
4799HIV-1 Vpr (13-33)XX
4800isolated reduced c domain of the cytochrome cd1 nitrite reductaseXX
4801isolated oxidized c domain of the cytochrome cd1 nitrite reductaseXX
4802N-terminal domain of H-NSXX
4818N-Terminal Domain of MKP-3XX
4820Pheromone Er-22XX
4822N terminal domain of Cardiac Troponin CXX
4823N terminal domain of Cardiac Troponin CXX
4824N terminal domain of Cardiac Troponin CXX
4825Recombinant RC-RNase 2XX
4829Interleukin enhancer binding factorXX
4831hen egg white lysozymeXX
4854N-terminal domain of 5-enolpyruvyl shikimate-3-phosphate synthaseXX
4864Turkey Ovomucoid Third DomainXX
4865Turkey Ovomucoid Third Domain bound to bovine chymotrypsin AaXX
4870region 4 of sigma70 of E. coli RNA polymerase holoenzymeXX
4874mSin3B-PAH2 free stateXX
4878Calreticulin P-domainXX
4881Azotobacter vinelandii C69A holoflavodoxin IIXX
48841st LIM domain of PINCH proteinXX
4886Azotobacter vinelandii C69A apoflavodoxin IIXX
4888c-Src SH3 monomerXX
4889c-Src SH3 RLP2 peptide complexXX
4891chinese cobrotoxinXX
4893Recombinant RC-RNase 4XX
4896response-regulator protein CheY2XX
4897Pilus Associated with Pyelonephritis subunit GXX
4900C-terminal xylan binding moduleXX
4905G88W110 fragment of staphylococcal nucleaseXX
4910LEKTI domain oneXX
4911DYNEIN light chain 8 (dlc8) and nNOS (fragment peptide) complexXX
4913cAMP-regulated phosphoprotein-19 monomerXX
4919ERp29 N-domainXX
4920ERp29 C-domainXX
4922unfolded apoplastocyaninXX
4924Tityustoxin K-alphaXX
4926chymotrypsin inhibitor 2XX
4929Tctex1 dimerXX
4934p53 dimerXX
4936Outer membrane protein X in DHPC micellesXX
4938mouse doppelXX
4941Ku70 DNA binding domain at the C-terminusXX
4943Chicken Egg White LysozymeXX
4945Vam3p N-terminal domainXX
4950HIV-1 NefXX
4951HIV-1 NefXX
4953trigger factor PPIase domainXX
4954Riboflavin Synthase N-domainXX
4955Cysteinyl-phosphorylated enzyme IIBXX
4961YopH complexXX
4966Cardiotoxin A3XX
4967Mason-Pfizer Monkey Virus proteaseXX
4969Bruc D4.4 VH fragmentXX
4971Truncated amino-terminal Carp Granulin-1XX
4974Chymotrypsin Inhibitor 2XX
4977lipid transfer proteinXX
4978B0 isoform of the 3rd(C-terminal) globular domain of agrinXX
4981fifth domain of beta2-glycoprotein IXX
4985flavodoxin-like domain of the Escherichia coli sulfite reductaseXX
4991thioredoxin like proteinXX
4992toluene 4-monooxygenaseXX
4995GlyTM1bZip coiled-coil dimerXX
4999nucleocapsid binding domain of the sendai virus phosphoproteinXX
5000C-Terminal Domain of PAC-1XX
5004human interleukin-13XX
5010DNA Polymerase XXX
5012the third domain of MMP-2XX
5013E6AP catalytic domainXX
5014MyBP-C cC5XX
5027human fibronectin EDAXX
5031KaiA N-terminusXX
5040I1(I29T) monomerXX
5041DNA Ligase III, BRCT domain (E.C.
5042Human lymphotactin monomerXX
5047LCCL module of human coch-5b2 proteinXX
5048cellular retinol-binding protein type IXX
5050Bungarus fasciatus IXXX
5052neurotoxin IIXX
5053C-terminal domain of Pab1pXX
5054Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase complexed with ATPXX
5056Arabidopsis thaliana trypsin/chymotrypsin inhibitorXX
5057Alzheimer peptide Ab(1-40) of manXX
5060TM006 protein from Thermotoga maritimaXX
5061DNA-binding domain of ADR6XX
5064GABAA receptor associated proteinXX
5067lipoyl domain of dihydrolipoyl dehydrogenase P64KXX
5070C-terminal domain of tyrosyl-tRNA synthetaseXX
5071troponin C, skeletal muscleXX
5072CD3 Epsilon and gamma Ectodomain Fragment ComplexXX
5075Apolipoprotein(a) kringle IV type 6XX
5078Lipoyl acid-bearing domain of human BCKD complexXX
5079cytochrome c552XX
5080cytochrome c552XX
5081Gallium protoporphyrin IX-HasAsm complexXX
5082Tc1 monomerXX
5083Epidermal-type fatty acid binding proteinXX
5084PABC-Paip1 complexXX
5085PABC-Paip2 complexXX
5086Hydrogenobacter thermophilus cytochrome c-552XX
5087Hydrogenobacter thermophilus cytochrome c-552XX
5088Hydrogenobacter thermophilus cytochrome c-552XX
5089Hydrogenobacter thermophilus cytochrome c-552XX
5092beta2 subunit of BK channelsXX
5099N-terminus of Tissue Inhibitor of Metalloproteinases-1/Matrix MetalloProteinase-3(E202Q)(deltaC) complexXX
5100Intramolecular complex of LMO2(LIM1) and ldb1(LID)XX
5101ubiquitin fragmentXX
5102SK2 calmodulin binding domainXX
5103s100p dimerXX
5107Sensor and Substrate Binding Domain from Lon (La) Protease (E. coli)XX
5115gamma subunit of dissimilatory siroheme-sulfite reductaseXX
5116gamma subunit of dissimilatory siroheme-sulfite reductaseXX
5119subunit c of ATP synthaseXX
5120mEGF/TGFalpha44-50 chimeraXX
5121N-terminal domain of DnaB helicaseXX
5122cyclic N-terminal domain of DnaB helicaseXX
5127murine mts1XX
5128GABARAP monomerXX
5129MTH1880 without calciumXX
5130human lysozyme at 35 degree CXX
5131Second PDZ domain of PTP-BLXX
5141SasA N-terminusXX
5142human lysozymeXX
5143alpha2A adrenergic receptorXX
5145human DoppelXX
5149D130I mutant T3-I2(D130I) peptideXX
5150T3-I2-T4 peptideXX
5153N-terminal domain of Tissue Inhibitor of Metalloproteinases-1/MatrixMetalloProteinase-3(E202Q)(deltaC) complexXX
5154N-terminal domain of Tissue Inhibitor of Metalloproteinases-1XX
5159Ran-binding domain 2 of RanBP2XX
5161Nucleotide binding domain of the Sarco(Endo)plasmic Reticulum Ca2+-ATPaseXX
5165Conserved Hypothetical Protein MTH1598XX
5166hemolysin expression modulating protein HhaXX
5172Oxidized cytochrome c553 from Bacillus pasteuriiXX
5173Epiregulin monomerXX
5177chick cofilinXX
5178chitinase fibronectin type III domainXX
5179vav n-terminal SH3 domainXX
5182GluR2 Extracellular Ligand-Binding DomainXX
5184toxin BeKm from the scorpion Buthus eupeusXX
5185vascular endothelial growth factor receptor-binding domain dimer in complex with peptide v107XX
5186vascular endothelial growth factor receptor-binding domain dimerXX
5187TraR monomerXX
5188paralytic peptide of Bombyx moriXX
5189S100A11 homodimerXX
5190ribosome recycling factorXX
5191ribosome recycling factorXX
5196Skeletal Dihydropydrine ReceptorXX
5197mouse prion proteinXX
5198peptide v107 in complex with vascular endothelial growth factor receptor-binding domain dimerXX
5199necrosis inducing proteinXX
5202CNP catalytic domainXX
5203cysteine-rich domain of KSRXX
5204Calreticulin P-domain fragment 189-261XX
5205Calreticulin P-domain fragment 221-256XX
5206S100B dimerXX
5208Palm-Thumb Domain of DNA Polymerase BXX
5209Palm-Thumb Domain of DNA Polymerase B in complex with XRCC1-NTDXX
5214Y2 selective analogue I of neuropeptide YXX
5215Y2 selective analogue II of neuropeptide YXX
5216Y2 selective analogue III of neuropeptide YXX
5219Escherichia coli formamidopyrimidine-DNA glycosylaseXX
5220Melanoma Inhibitory Activity ProteinXX
5221C-Terminal Region of Ku86XX
5223SH3 domain of the tyrosine-protein kinase LckXX
5225Parvulin 10XX
5226Ssh10b dimerXX
5227smMLCK:CaM complexXX
5228ACTR in complex with the CREB binding protein, CBPXX
5234TyrR transcription factor central domain of E.coliXX
5235Human Lupus autoantigen proteinXX
5238heparin-binding domain of vascular endothelial growth factor-165XX
5239dvh c3oxXX
5242prohormone convertase 1 pro-domainXX
5244endonuclease VXX
5246Human insulin mutantXX
5247murine mts1XX
5248Pin1 N-terminal WW domainXX
5250GlcT-RBD dimerXX
5257Thymosin beta-9XX
5261Nuclease A InhibitorXX
5262first fibronectin type II module of human matrix metalloproteinase 2XX
5263CBM28 of CelIXX
5264Human Beta-defensin 3XX
5265moricin monomerXX
5267SdbA type II cohesin moduleXX
5268tachystatin AXX
5272Schistocerca gregaria chymotrypsin inhibitorXX
5273Schistocerca gregaria chymotrypsin inhibitor variant L30R,K31MXX
5274Schistocerca gregaria trypsin inhibitorXX
5275sialic acid binding domain of rhesus rotavirus VP4XX
5278Pea Enation Mosaic Virus P1-P2 frameshifting pseudoknotXX
5283HIV-1 Vpr (34-51)XX
5286CaM:CaMKIp complexXX
5287CaM:CaMKI(320) complexXX
5288Grb7 SH2 domain / phosphorylated peptide complexXX
5289third helix of Antennapedia homeodomainXX
5290third helix[W6F,W14F] of Antennapedia homeodomainXX
529112 amino acid long derivative of the third helix of Antennapedia homeodomainXX
5292Trp-cage Construct 5bXX
5293Barstar pH 2.7 160 kD aggregateXX
5294beta subunit of translation initiation factor 2XX
5296brazzein RIXX
5298PPIase monomerXX
5300ORF C32E8.3XX
5302Islet amyloid polypeptideXX
5305Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1XX
5306hypoxia inducible factor-1alpha/p300 complexXX
5307Basic Pancreatic Trypsin InhibitorXX
5308Human-E.coli chimeric thioredoxinXX
5309Fusion of the LIM binding domain of Ldb1 and the N-terminal LIM domain of LMO4XX
5313Gap Junction 43kDa Carboxyl TerminusXX
5314Grb14 SH2 domain/phosphorylated undecapeptide complexXX
5315Protein YfiaXX
5319cellular retinol-binding protein type IXX
5322gamma-bungarotoxin monomerXX
5325Plant nsLTP2XX
5327Hif-1alpha/CBP complexXX
5328DNA Ligase BRCT domainXX
5329C. elegans protein ZK652.3XX
5330cellular retinol-binding protein type IXX
5331cellular retinol-binding protein type IXX
5332recoverin mutant, E85QXX
5333cytochrome c3XX
5334NTD HTLV-I capsid proteinXX
5337human adrenodoxinXX
5340proapoptotic bidXX
5343Neocarzinostatin apo-proteinXX
5344Neocarzinostatin apo-protein - small molecule complexXX
5346platelet aggregation inhibitor disintegrinXX
5347RNase H domain of the HIV-1 reverse transcriptaseXX
5348ati monomerXX
5349Extended PBX Homeodomain-DNA complexXXX
5350human cytoplasmic tyrosine phosphatase AXX
5352xylanase of Bacillus agaradhaerensXX
5353yeast Saccharomyces cerevisiae calmodulinXX
5354Human PAS Kinase PAS-A domainXX
5355Hsp90 N-terminal ATPase domainXX
5356GS-a3W proteinXX
5363hERR2-DNA complexXXX
5366Vacuolar morphogenesis proteinXX
5368human ADP Ribosylation Factor 1XX
5374protein of 2S albumin storage protein from Ricinus communisXX
5376complex of transducin peptide and rhodopsinXX
5377Ca(2+)S100B-TRTK-12 peptide complexXX
5378Human prion protein fragment 121-230 with mutations Met166Cys and Glu221CysXX
5382the C-terminal domain of EPSP synthaseXX
5384Glycine extended gastrin peptideXX
5386cNTnC-cTnI(147-162)-Bepridil Ternary ComplexXX
5388Gads C-terminal SH3 domainXX
5390DNA-binding Protein H-NSXX
5394U2 snRNA - Intron duplexXX
5395Unmodified U2 snRNA - Intron duplexXX
5396ternary complex DHFR-trimethoprim-NADPHXX
53983-methyladenine DNA glycosylase IXX
5399Erg Pointed DomainXX
5400beta-amyloid 1-42XX
5401GABPalpha Pointed DomainXX
5402sh2 domainXX
5403trp RNA-binding attenuation protein undecamerXX
5404E. coli Peptide DeformylaseXX
5405peptide n3XX
5408DFF40/DFF45 heterodimerXX
5412P2'-Lys OMTKY3XX
5413P2'-His OMTKY3XX
5414P2'-Glu OMTKY3XX
5415P2'-Asp OMTKY3XX
5416P3'-Ala OMTKY3XX
5417P3'-Asp OMTKY3XX
5418P3'-Glu OMTKY3XX
5419P3'-His OMTKY3XX
5420P3'-Lys OMTKY3XX
5421P1'-Asp OMTKY3XX
5422P1'-His OMTKY3XX
5423P1'-Lys OMTKY3XX
5424P1-Asp OMTKY3XX
5425P1-Glu OMTKY3XX
5426P1-Gly OMTKY3XX
5427P1-Ala OMTKY3XX
5428P1-His OMTKY3XX
5429P1-Lys OMTKY3XX
5430P2-Asp OMTKY3XX
5431P2-Glu OMTKY3XX
5432P2-Val OMTKY3XX
5433P2-His OMTKY3XX
5434P2-Lys OMTKY3XX
5435P4-Asp OMTKY3XX
5436P4-Glu OMTKY3XX
5437P4-His OMTKY3XX
5438P4-Lys OMTKY3XX
5439P4-Asp OMTKY3XX
5440P5-Asp OMTKY3XX
5441P5-Glu OMTKY3XX
5442P5-His OMTKY3XX
5443P6-Asp OMTKY3XX
5444P6-Glu OMTKY3XX
5445P6-His OMTKY3XX
5446P2-Val,P3'-Ala OMTKY3XX
5447P8-Phe,P6-Asp OMTKY3XX
5449P5-His OMTKY3XX
5450P4-Glu OMTKY3XX
5456von Willebrand factor-A3 domainXX
5457complex of hMad1-Sin Interacting Domain (SID) and PAH2 domain of mSin3BXX
5458Ribosome Recycling FactorXX
5459EL5 RING-H2 finger domainXX
5461Interleukin-2 tyrosine kinase src homology 2 domainXX
5469omsvp3 monomerXX
5470p14c/n39c monomerXX
5472Ovomucoid Third DomainXX
5473Ovomucoid Third DomainXX
5475plastocyanin synechocistys PCC 6803XX
5480Calmodulin-olfactory channel peptide complexXX
5482DC 45-150XX
5483N-acetylmuramyl-L-alanine amidaseXX
5484BpUreE dimerXX
5486Tachyplesin IXX
5487Tachyplesin I, tyrosine mutantXX
5488Tachyplesin I, phenylalanine mutantXX
5489Tachyplesin I, alanine mutantXX
5490Pru av 1 E45WXX
5491scarabaecin monomerXX
5493Acyl carrier protein synthaseXX
5494PW2 Bound to SDS MicellesXX
5496ubiquitin-like domain in murine PARKINXX
5497DsbD C-terminal domainXX
5499AMPA receptor interacting proteinXX
5504Csk homologous kinase SH2 domainXX
5505Cu (II) Plastocyanin from Anabaena VariabilisXX
5506double moduleXX
5507Transthyretin TetramerXX
5511p21 Rac1 GTPaseXX
5515Dishevelled-2 DIX dimerXX
5518Turkey Ovomucoid Third DomainXX
5519Indian Peafowl Ovomucoid Third DomainXX
5520Turkey Ovomucoid Third DomainXX
5521Indian Peafowl Ovomucoid Third DomainXX
55224th fas-1 domain of beta ig-h3XX
5523Melanin-Concentrating HormoneXX
5532Tumor Susceptibility gene 101 protein/Gag PolyproteinXX
5534Apolipoprotein CII in complex with SDS-micellesXX
5535R3H domainXX
5536G88W110 fragment of Staphylococcal NucleaseXX
5538PWWP domainXX
5539Xis C28SXX
5540flavodoxin monomerXX
5544Ca2+-loaded S100B(beta beta)-TRTK-12 peptide complexXX
5547streptococcal pyrogenic exotoxin BXX
5551LEKTI domain 6 (HF7665) monomerXX
5554N-WASP EVH1 Domain-WIP complexXX
5558Sp100b SAND domainXX
5560TM1290 conserved hypothetical proteinXX
5563ParG dimerXX
5564kinase associated protein phosphatase kinase interaction domainXX
5565porcine MSPXX
5571flavodoxin monomerXX
5572spruce budworm antifreeze proteinXX
5573spruce budworm antifreeze proteinXX
5580Type B lantibiotic mersacidinXX
5581Type B lantibiotic mersacidinXX
5582Type B lantibiotic mersacidinXX
5585alpha-conotoxin GIDXX
5590DNA-binding domain in RTBP1XX
5591cC2 domainXX
5594U-box from Prp19XX
5597cytochrome cXX
5598receptor associated protein-domain 1XX
5599Human ProlactinXX
5604ZNTA (E.C.
5607Human Neuronal Glycine Receptor alpha-1 Chain TM2XX
5609kalata B1XX
5610C terminus of rat striated muscle alpha tropomyosin encoded by exon 9aXX
5612floral defensin-like protein 1XX
5613bhpW, disulfide cyclized beta-hairpin peptideXX
5619methionine sulfoxide reductase BXX
5620ribosomal protein S28EXX
5621yoag ecoliXX
5623matrix protein from Moloney Murine Leukemia Virus matrix proteinXX
5624translation initiation factor IF2XX
5626Droshophila GCMXX
5627A. aeolicus UDP-3-O-acyl-GlcNAc deacetylase in complex with TU-514XX
5628C-terminal domain [276-437] of the human EF1Bgamma subunit from elongation factor 1XX
5630ER75 monomerXX
5651Txk SH3 domainXX
5656staphylococcal protein A Z domainXX
5657Methanobacterium thermoautotrophicumXX
5660oxidized cytochrome cXX
5661PKC iota (V1 domain)XX
5663CPI-17(22-120) mutant T38DXX
5664oxytetracycline acyl carrier proteinXX
5665Clpx Zinc Finger dimerXX
5666truncated GFPuvXX
5667First zinc finger of Zinc finger protein 265XX
56683-methyladenine DNA glycosylase IXX
5669Npl4 Zinc Finger domainXX
5670Hellethionin DXX
5676Pandinus imperator potassium channel blocking toxin 4XX
5677focal adhesion targeting domain of focal adhesion kinaseXX
5678HNF6 proteinXX
5679xylan-binding domainXX
5680CFP-10 in complex with unlabelled ESAT-6XX
568230S ribosomal protein S27eXX
5687protein S-824XX
5688cathelin-like domain of the protegrin-3 precursorXX
5689Pheromone Binding Protein from Antheraea polyphemusXX
5690cobra neurotoxin IIXX
569130S ribosomal protein S28EXX
56924th LIM domain of PINCH proteinXX
5693Ligand loaded growth factor receptor-bound protein 2XX
5695YHR087W gene productXX
5696ZASP-PDZ DomainXX
5697ZASP-PDZ domain in complex with Alpha-Actinin-2 EF-hand domainsXX
5698C-terminal domain of poly(A)-binding proteinXX
5700p63 DNA-binding domainXX
5701SopE2 momomerXX
5707Bet v 4XX
5708PTS system, glucose-specific IIA component (E.C.
5709TPR domain of hSGTXX
5710Mth11 free in solutionXX
5711Biotinoyl domain of HP0371XX
5713human prion proteinXX
5714Synthetic DNA duplex with an AG mismatchXX
5715HHP-tagged E. coli ThioredoxinXX
5719La proteinXX
5722complex between Ca2+/C-terminal domain of caltractin and 19-resiude peptide from Kar1pXX
5723wt brazzeinXX
5729C-terminal SH3 domain of SEM-5 from C. elegansXX
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplexXX
5731SCR3 peptide (18-34)XX
5732SCR3 peptide (18-54)XX
5733SCR3 peptide (34-54)XX
5734SCR3 peptide (27-33)XX
5735rat amyloid beta-peptide 1-28XX
5740Dihydrofolate reductaseXX
5741Dihydrofolate reductaseXX
5742COX assembly proteinXX
5743extracellular domain of beta subunit of dystroglycanXX
5744human alpha-synucleinXX
5745bovine microsomal cytochrome b5XX
5747Homodimeric Alpha2 Four-Helix BundleXX
5748p270 or Human SWI1XX
5749Sl-moricin monomerXX
5750BLyS Receptor 3XX
5752human Integrin alpha2 I-domainXX
5754VASP EVH1 domainXX
5755Phosphatase Regenerating Liver 2XX
5756fluorescein-binding lipocalinXX
5759cytochrome P450camXX
5761gamma-adaptin ear domainXX
5771tff3 dimerXX
5772SlxA CBM13XX
5774Cleavage stimulation Factor 64, RRM domainXX
5778Pleckstrin Homology domain of the human Protein Kinase B betaXX
5781Propynyl DNA.RNA hybridXXX
5785Matrix MetalloProteinase-3 in complex with N-TIMP-1XX
5786Neural cadherinXX
5787RC-RNase 3XX
5788CBP/p300-interacting transactivators with a glutamic acid/aspartic acid (ED)-rich tail/p300 complexXX
5789nitrogen regulatory enzyme IIAXX
5790Hypothetical protein AQ 1857XX
5793RecR dimerXX
5794Lck SH3-SH2 domain pairXX
5797Hypothetical protein ta1414XX
5798Protein yrbAXX
5799PSP monomerXX
5800Escherichia coli N utilization substance (339-495)XX
5802Outer mitochondrial membrane cytochrome b5XX
5803hen egg white lysozymeXX
5804hen egg white lysozymeXX
5809human hemglobin AXX
5810cysteine proteinase inhibitorXX
5811GGRRDGGYGG monomerXX
5812GGYGGGRRDG monomerXX
5814C terminal domain of human VIAFXX
5816YLR109w dimerXX
5817Neurogenic locus notch homolog protein 1XX
5819CuA domainXX
5824KaiA C-terminal domainXX
5825KaiA C-terminal domainXX
5827Horse cytochrome cXX
5828Horse cytochrome cXX
5829Horse cytochrome c (wt) reduced formXX
5830Horse cytochrome c (wt) oxidized formXX
5834HIV-1 frameshift inducing stem-loop RNAXX
5835Recombinant onconaseXX
5837Sodium ChannelXX
5841kinase associated protein phosphatase, kinase interaction domainXX
5843expressed protein: At3g17210.1XX
5845MW2441 proteinXX
5846MR19 monomerXX
5848S-locus pollen proteinXX
5850protein tyrosine phosphatase (E.C.
5852A mimic of the VS Ribozyme Hairpin SubstrateXX
5860Subtilosin AXX
5861gtpase domain MnmEXX
5862TRADD death domainXX
5864Neurokinin BXX
5868UV excision repair protein RAD23 homolog BXX
5869Alpha-A-conotoxin EIVAXX
5871Ara h 6XX
5873BlaI N-terminal domainXX
5874p47 monomerXX
5876p47 monomerXX
5878region 1463-1617 of mouse 53BP1XX
5879S.typhi type IVb pilinXX
5883eumenine mastoparanXX
5886TF1 ATPase Beta SubunitXX
5887nuclear transport factor 2XX
5888nuclear transport factor 2 W7A mutantXX
5889nucleoporin Nsp1 528-557XX
5890Hylaseptin P1XX
5893VU-1 calmodulinXX
5894drosophila SLBP N-terminusXX
5896VU-1 calmodulin/F-stop complexXX
5897homolog Bcl-2 Epstein Barr VirusXX
5899Sporulation initiation phosphotransferase FXX
5902Hath domain of hepatoma-derived growth factor (hHDGF)XX
5906dopamine and cAMP-regulated phosphoprotein, Mr. 32,000XX
5907Ku80 CTDXX
5908Sac7d V30I monomerXX
5909Sso7d monomerXX
5910Sso7d monomerXX
5912ATP-dependent DNA helicase II, 80 kDa subunitXX
5913Neurotoxin Cn11XX
5916empaf, eumenine mastoparanXX
5918Thermus thermophilus Ribonuclease HIXX
5919Loop E of 5S rRNA from spinach chloroplastsXX
5920PrrA C-terminal domainXX
5922Potassium voltage-gated channel subfamily H member 2XX
5923T22G mutant of the N-terminal SH3 domain of the Drosophila protein drkXX
5924FAT domain of Focal adhesion kinase (920-1053)XX
5925SH2-SH3 adapter protein drkXX
5929hypothetical rhodanase domainXX
5931RNase H domain of the HIV-1 reverse transcriptaseXX
5934f-MLF peptideXX
5937PDZ2b domain of PTP-Bas (hPTP1E)XX
5939Spred2 EVH1 domainXX
5940third domain of the interleukin-6 receptorXX
5944CD4 cytoplasmic tail - Lck N terminusXX
5945CD8a cytoplasmic tail - Lck N terminusXX
5947donor strand complemented AfaE-IIIXX
5948Disintegrin kistrin, AKGDWN MutantXX
5949Disintegrin kistrin, ARGDWN MutantXX
5950Cell division Activator CedAXX
5953Human TGFB type II Receptor and Monomeric TGFB3 ComplexXX
5954Human TGFB type II ReceptorXX
5955VASP EVH2 domainXX
5958MAP-LC3 monomerXX
5959Antigen Ki-67 FHA domainXX
5966headpiece subdomainXX
597050S Ribosomal Protein L18XX
5971Domain III of the E protein of Langat flavivirusXX
5972ProP antiparallel coiled-coilXX
5973Dengue type 2 virus capsid proteinXX
5975N-terminal domain of trout cardiac troponin CXX
5976hypothetical protein TM0487XX
5978HCV NS5A N-terminalXX
5981ternary complex of human DHFR with trimethoprim and NADPHXX
59835,10-methenyltetrahydrofolate synthetaseXX
5984FtsN RNP domainXX
5985alpha-Conotoxin GICXX
5986paralytic peptide of Antheraea yamamaiXX
5987CBP TAZ1 domain and CITED2 CADXX
5988alpha-bungarotoxin/ nicotinic acetylcholine receptor mimotope complexXX
5989Cytotoxin IXX
5991Murine Ets-1 deltaN301XX
5993DNA duplexXX
5995Major Urinary Protein-IXX
5996Major Urinary Protein-IXX
5997STAT4 N-terminal domain, dimerXX
5998ApaG/CorD proteinXX
6000Drosophila Argonaute1 PAZ domainXX
6002p63 monomerXX
6004Cofilin, non-muscle isoformXX
6005TIS11d TZF/ 5'-UUAUUUAUU-3' complexXXX
6007tn3 calcium free formXX
6008tn3 with calcium boundXX
6012Sgt1 CS domainXX
6013alpha-actinin-4 spectrin repeat 3XX
6015cC1 domainXX
6016beta-site APP Cleaving Enzyme 1XX
6017S100C/A11 fragmentXX
6018phosphorylated S100C/A11 fragmentXX
6019P62A dimerXX
6020Polyphemusin IXX
6021subunit a of the ATP synthaseXX
6022Copper-transporting ATPase 1XX
6023calmodulin-protein phosphatase 2B peptide complexXX
6024Beta-lactamase TEMXX
6025leukocyte cell-derived chemotaxin 2XX
6026Oxidized Human FerredoxinXX
6027Mu-conotoxin PIIIAXX
6028ribosomal protein S17EXX
6029Type IA potassium translocating ATPase B chainXX
6030Type IA potassium translocating ATPase B chainXX
6033C10A/C13A cytochrome c552 from Hydrogenobacter thermphilusXX
6034ear-domain of alpha-adaptin CXX
6035DNA ligase III alpha 1-117XX
6038Small inducible cytokine B11XX
604230mer stemloop-D of coxsackieviral RNAXX
6044La proteinXX
6045pfr13 monomerXX
6046West Nile Virus I, strain 385-99, Domain IIIXX
6047Organomercurial LyaseXX
6048Hb3361a peptideXX
6049Parvalbumin alphaXX
6050Endoribonuclease SSO7D single point mutant K12LXX
6051methionine sulfoxide reductase BXX
6053the N-terminal 16kDa domain of Ada ProteinXX
6054the methylated N-terminal 16kDa domain of Ada ProteinXX
6055merB / Hg / DTT complexXX
6056Yeast oligosaccharyltransferase subunit Ost4pXX
6057tandem SH3 domain in autoinhibited form of p47phoxXX
6058Hypothetical Archaeglobus fulgidis protein AF2095XX
6060PDZ2 from PTP-BLXX
6061T1-61-DNase fusion proteinXX
6066K27A Hainantoxin-IVXX
6067K27A Hainantoxin-IVXX
6069Precarnobacteriocin B2XX
6072Protein inhibitor of activated STAT protein 1XX
6073Hypothetical superoxide dismutase-like protein yojMXX
6076stem-loop RNAXX
6077stem-loop RNAXX
6079thioredoxin h1 from poplarXX
6081troponin CXX
6082methionine-rich 2S albumin from Sunflower seedXX
6086recombinant MAGI-1 tandem WW domain regionXX
6087HCV p7XX
6090methionine sulfoxide reductase AXX
6091PDZ2 from PTP-BLXX
6092PDZ2 from PTP-BLXX
6094Psi site of MLVXX
6095CBP KIX domain and c-MybXX
6096Dynein light chain 1, cytoplasmicXX
6097U1C zinc finger domainXX
6102Hypothetical UPF0250 protein ybeDXX
6108Glycogen synthesis protein glgSXX
6110mutant of LEKTI domain 1XX
6111Choristoneura fumiferana antifreeze protein isoform 501XX
6114BRCTc domainXX
6115Rhonivirus CREXX
6116N-terminal domain of human eRF1XX
6120Hypothetical protein CC1736XX
6122S1 monomerXX
6123Truncated hevein of 32 aaXX
6125enolase-phosphatase E1XX
6127p1 encoded proteinXX
6131Cytochrome b5XX
6132poplar phloem peroxiredoxinXX
6135Mu-O-conotoxin MrVIBXX
6136E. coli L-Arabinose Binding ProteinXX
6137proBnIb monomerXX
6139Oela europea pollen allergen ole e 6XX
6143apolipoprotein C-IIXX
61453LII in DMSOXX
6146nisin/3LII complexXX
6150fatty acid binding proteinXX
6154tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)XX
6155tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)XX
6156tandem repeat 1 of fibroin-modulator-binding-protein-1(residues 99-121)XX
6157tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)XX
6158saposin CXX
6174ThKaiA180C-CIIABD complexXX
6176Ubiquitin-like domain of tubulin-folding cofactor BXX
6179LEKTI Domain 15 shortXX
6180LEKTI Domain 15XX
6183cAMP-dependent protein kinaseXX
6184N-terminal domain of the epsilon subunit of E. coli DNA polymerase IIIXX
6187hypothetical protein PF1061XX
6193PSD-95 PDZ3XX
6197Src homology-3 domainXX
6198TM1816 monomerXX
61995,10 methenyltetrahydrofolate synthetaseXX
6203insulin analogueXX
6204insulin analogueXX
6205insulin analogueXX
6209N-domain of At3g03410.1XX
6211Carnobacteriocin B2 immunity proteinXX
6216Zinc finger protein ZFPM1XX
6217Cytotoxic linear peptide IsCTXX
6218Cytotoxic linear peptide IsCTXX
6223YCD dimerXX
6226EW29 monomerXX
6228yeast TOR1 FATCXX
6229Thermus Thermophilus Dnak Nucleotide binding domainXX
6230human hemglobin AXX
6235SNARE complexXX
6237alpha-conotoxin OmIAXX
6241josephin domain of ataxin-3XX
6244Mycoplasma Genitalium gi3844938XX
6255Ribosomal Protein L16XX
6256TM1509 monomerXX
6258g3pN1 bound TolAIIIXX
6260IAAL-E3/K3 heterodimerXX
6261SH3 domain of Lyn Tyrosine KinaseXX
6269chPrP (128-242)XX
6270chPrP (25-242)XX
6275Metal-response element-binding transcription factor-1XX
6276Metal-response element-binding transcription factor-1 complex with MRE DNAXXX
6278yeast Sed5pXX
6279murine angiogenin 4XX
6280double-stranded RNA-binding domains of adenosine deaminase acting on RNAXX
6281Complexin/SNARE complexXX
6282turtle PrP monomerXX
6285talin 755-889XX
6287GABPalpha pointed domainXX
6288Neurotoxin IXX
6289SecA CtXX
6290Nc metallothioneinXX
6291hypothetical membrane protein ta0354 69 121XX
6292Alkaline protease inhibitorXX
6293tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)XX
6294tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)XX
6295flavin domain of methane monooxygenase reductaseXX
6296tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)XX
6308ERp57, domain aXX
6311Spry domain-containing SOCS box protein 2XX
6313Pheromone-binding proteinXX
6317CylR2 dimerXX
6318Thioredoxin h1XX
6320U6 extended ISLXX
6324hypothetical protein TM0979XX
6325CREB Binding Protein (E.C.
6326CREB Binding ProteinXX
6327CREB Binding Protein (E.C.
6328CREB Binding Protein (E.C.
6329CREB Binding Protein (E.C.
6331SH2 domainXX
6332myosin light chainXX
6334Mip (77-213) monomerXX
6335redox-switch domain of Hsp33XX
6336AP4A hydrolase with ATPXX
6342survivin dimerXX
6346h. plexin-B1 RBD-W1830FXX
6353RFC p140 375-480 BRCT region : DNA complexXXX
6354N-terminal domain of NECAP1 proteinXX
6356Yeast Frataxin homolog 1 proteinXX
6357Beta-lactamase TEMXX
6358Xcc975 monomerXX
636040-61 bovine alpha-hemoglobin fragmentXX
6362NifU-like proteinXX
6364PF0470 monomerXX
6365Protein BC4709XX
6366Hypothetical protein yqbGXX
6367Hypothetical protein yhgGXX
6368Hypothetical protein rps24eXX
6369Protein BH1534XX
6371Sin3a associated polypeptide p18XX
6373catalytic domain of LexA L89P/Q92W/D150H/E152A/K156A mutant dimerXX
6375TonB C-terminal Domain monomerXX
6377fPrP monomerXX
6378canine prion proteinXX
6380pig prion protein monomerXX
6381ovPrP,H168 monomerXX
6382prion proteinXX
6383eprp monomerXX
6384Tumor necrosis factor receptor superfamily member 13BXX
6385human pleckstrin Dep domainXX
6386aei monomerXX
6387aei-analogue monomerXX
6392human TSG-6XX
6393human TSG-6XXX
6395DivIB monomerXX
6399TPR domain in p67phoxXX
6400wt maXX
6402CsrA dimerXX
6403Ovine Prion Protein Variant R168XX
6404Pcf11 CIDXX
6406TCR Va2.6Ja38XX
6407HPV16 E6 C-terminal domainXX
6408Metal-responsive element-binding transcription factor-1XX
6409Metal-responsive element-binding transcription factor-1XX
6411amidated fragment 48-61 of bovine alpha-hemoglobinXX
6412fragment 48-61of bovine alpha-hemoglobinXX
6413fragment 40-61XX
6414amidated fragment 33-52 of bovine alpha-hemoglobinXX
6415hen egg white lysozymeXX
6418aequorin/Mg2+-bound stateXX
6419Variant surface glycoprotein MITAT 1.2XX
6427Antifreeze peptide SS-3XX
6431II-III loop region of the skeletal dyhydropyridine receptorXX
6433Entamoeba histolytica calcium binding protein 2XX
6437lf11 peptideXX
6438CikA C-terminusXX
6445Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)XXX
6446Sodium/hydrogen exchanger 1XX
6447Major vault proteinXX
6448Hypothetical UPF0131 protein ytfPXX
6451CesT dimerXX
6452CLP-36 PDZXX
6456SH3 domain of Lyn Tyrosine Kinase with a herpesviral ligandXX
6459Itch WW3 domainXX
6468mitogen-activated protein kinase p38 alphaXX
6474KI-FHA domain of KAPPXX
6478Transition state regulatory protein abrBXX
6479Excisionase from transposon Tn916XX
6485GluR-B R/G RNAXX
6488Ubiquitin solutionXX
6494BsCM trimerXX
6495BsCM trimerXX
6496BsCM trimerXX
6500Siah-Interacting Protein (Residues 74-178)XX
6501Nsp9 dimerXX
6502XPF/ERCC-1 heterodimerXX
6503apo v-Src SH2XX
6510AMA1 Domain IIXX
6511peptide SDXX
6512Vaccinia Virus envelope protein A27LXX
6513non structural protein 7XX
6516holo-acyl carrier proteinXX
6520Pcf monomerXX
6524apoE N-terminal domainXX
6525Mungbean Defensin, VrD1XX
6527Km23 homodimerXX
6533DNA binding domain of STPAXX
6536hSH3-1 domainXX
65382B4 monomerXX
6539hSH3-1 domainXX
6541Ca-bound calmodulinXX
6542Arginine kinaseXX
6546CGI-126 monomerXX
6547polyhistidine peptideXX
6551DNA excision repair protein ERCC-1, DNA repair endonuclease XPF (E.C.3.1.-.-)XX
6555protein YBL071w-AXX
6556Programmed cell death protein 5XX
6557preS2 surface antigenXX
6561plantaricin AXX
6563arsenate reductaseXX
6566Measles virus N protein (amino acids 477-505)XX
6567Measles virus N protein (amino acids 477-505) bound to the measles virus P protein (amino acids 457-507)XX
6568Measles virus P protein (amino acids 457-507)XX
6569Measles virus P protein (amino acids 457-507) bound to the measles virus N protein (amino acids 477-505)XX
6573vacuolar protein sorting factor 4AXX
6575Nck2 SH2 domainXX
6578bcl-xl /Bad BH3 peptide (NLWAAQRYGRELRRMSDEFVDSFKK)complexXX
6579JX EGFR monomerXX
6580socs3 bound to a phosphotyrosine peptideXX
6583S100A1 dimerXX
6587apolipoprotein A-IXX
6588apolipoprotein A-I(1-186)XX
6589Chromo domain 1 of cpSRP43XX
6591Phe18Pff and Tyr20Pff AcAMP2 double mutantXX
6592Chromo2 domain of cpSRP43XX
6593Chromo 3 domain of cpSRP43XX
6594Leishmania major FYVE domain containing protein 1XX
6597Aryl hydrocarbon receptor nuclear translocatorXX
6598Prion-like protein doppelXX
6604v-Src-SH2 complexed with PQpYEEIPIXX
6605NMR ensemble Ada ProteinXXX
6606RPA70A from S.cervisiaeXX
6608PV5 solution structureXX
6609dendritic cell-derived ubiquitin-like proteinXX
6611receiver domain of NtrC4XX
6615BsLonSSD monomerXX
6616peptide P5XX
6617C-terminal haemopexin-like domain of matrix metalloproteinase MMP-13 (collagenase-3)XX
6618peptide P6XX
6619peptide P7XX
6620p22HBP monomerXX
6622reduced and S-methylated hen egg white lysozymeXX
6626Plant Tom20XX
6629Outer membrane usher protein FimDXX
6631Splicing factor 3 subunit 1XX
6637AcAMP2F18Nalb mutantXX
6638lmp2a NTDXX
6639AcAMP2F18W mutantXX
6643human prolactinXX
6644assembly AlgHXX
6646firefly luciferase domain residues 420-550XX
6647AcAMP2F18Wb mutantXX
6649Sporulation-specific N-acetylmuramoyl-L-alanine amidase (E.C.
6650St II fragmentsXX
6651St II fragmentsXX
6652GAAA tetraloop/Recptor homodimerXX
6655Zinc finger domains 1 and 2 of dsRBP-ZFaXX
6656AcAMP2F18Pff/F20Pfff mutantXX
6657AcAMP2F18Nal mutantXX
6660rubredoxin (V8A)XX
6661rubredoxin (V8A)XX
6663rubredoxin (V8G)XX
6664rubredoxin (V8G)XX
6665rubredoxin (V8G/V44G)XX
6666rubredoxin (V8G/V44G)XX
6667rubredoxin (V8I)XX
6668rubredoxin (V8I)XX
6669rubredoxin (V8L)XX
6670rubredoxin (V8L)XX
6671rubredoxin (V44A)XX
6672rubredoxin (V44A)XX
6673rubredoxin (V44G)XX
6674rubredoxin (V44G)XX
6675rubredoxin (V44I)XX
6676rubredoxin (V44I)XX
6677rubredoxin (V44L)XX
6678rubredoxin (V44L)XX
6680A219 monomerXX
6682Zinc finger protein 593XX
6687N-terminal domain of human centrin 2XX
6688Rv1980c (monomer)XX
6689human centrin 1XX
6690PSI AB complex with U1-70k proline-rich peptideXX
6691PSI AB region free proteinXX
6695FNR polypeptideXX
6696PP5-TPR-peptide complexXX
6698MSP2 peptideXX
6700TBP associated factor 1 (TAF1)XX
6702yeast TBP associated factor 1 (yTAF1)XX
6707paramecium calmodulinXX
6717Hypothetical UPF0213 protein BH0048XX
6720Alpha-conotoxin PIAXX
6722Low-Molecular-Weight Protein Tyrosine PhosphataseXX
6723soluble apo-CcmEXX
6724Der f 13XX
6725Dengue envelope protein domain IIIXX
6726CalC monomerXX
6727telomeric repeat-binding domain of Arabidopsis thalianaXX
6729DSP monomerXX
6736NMR structure of PA2021XX
6738Selenoprotein Sep15XX
6739Selenoprotein MXX
6741Pulmonary surfactant-associated protein BXX
6742ataxin-3 josephin domainXX
6746phnA-like protein rp4479XX
674750S ribosomal protein L40eXX
6748The Ki67FHA/hNIFK(226-269)3P complexXX
6749mSin3B PAH1 and NRSF/RESTXX
6752PH-PDZ tandem of alpha-syntrophinXX
6753split PH1 domain of alpha-syntrophinXX
6754PDZ domain of alpha-syntrophinXX
6757membrane anchor domain of BVDV NS5AXX
6759NEAT domainXX
6760FRB domainXX
6761UBL1 domain of TUGXX
6762Tor inhibition proteinXX
6763middle domain of human eRF1XX
6777beta PIX-SH3 complexed with an atypical peptide from alpha-PAKXX
6779Outer membrane usher protein fimDXX
6781ada2 swirm domain polypeptideXX
6787rabphilin C2A domainXX
6788Ser133-phosphorylated KIDXX
679018:0 ACP from spinachXX
6793Protein YsneXX
6800Domain III of the E protein of Langat flavivirusXX
6801Human SUMO-2 monomerXX
6803FecA N-terminal periplasmic signaling domainXX
6807Maltodextrin-binding protein (MBP)XX
6808N-terminal peptideXX
6809rabbitpox vCCIXX
6811cadmium-transporting ATPase (E.C.
6824SARS CoV 7a proteinXX
6827lah4 monomerXX
6828MazF homodimerXX
6829Chitin binding domainXX
6831CaM-cNOS peptide comlexXX
6832lipase PGXX
6833MazF(E24A)2-MazEp(54-77)2 heterotetramerXX
6834Huntingtin interacting protein B isoform 1XX
6835Fowlicidin 1XX
6837L27 Heterodimer From Lin-7 and Lin-2 Scaffold ProteinsXX
6843Caspase recruitment domain protein 4XX
6844U1 small nuclear ribonucleoprotein AXX
6845Ribosome biogenesis protein Nop10XX
6846H/ACA ribonucleoprotein complex subunit 3XX
6850PRP40 FF1XX
6851XPF dimer proteinXX
6855CIN85 B domainXX
6863Zinc finger domain of Mengovirus Leader polypeptideXX
6866Sorting nexin 22XX
6869DNA polymerase III subunit tauXX
6872kalata B8XX
6873C-PH domainXX
6874CBP-SID domain in complex with SRC1-AD1 domainXX
6877HPV-16 E2C-DNA complexXXX
6882sushi domain of the interleukin-15 receptorXX
6884YflL monomerXX
6885Ig1 moduleXX
6888Neocarzinostatin apo-protein with FlavoneXX
6892lung surfactant protein CXX
6894Ral guanine nucleotide dissociation stimulatorXX
6896Alpha-conotoxin ImIXX
6897Alpha-conotoxin ImIXX
6899PAH2 domainXX
6900Pdcd4 C-terminal MA-3 (319-449)XX
6903M-crystallin Ca2+ free form (APO)XX
6904M-Crystallin Ca2+ loaded (HOLO) monomerXX
6905Zap1 - monomerXX
6906Bicoid Homeodomain Bound to DNAXXX
6907V66W110 fragment of staphylococcal nucleaseXX
6908SNase110 fragment of Staphylococcal NucleaseXX
6912yeast thioredoxin 1XX
6913thioredoxin 2XX
6919MAN1 655-775 domainXX
6920Midline-1 B-box Type 1XX
6921human cytochrome b5 with oxydized hemeXX
6922Vts1:RNA dimerXXX
6924discrepin monomerXX
6925Kid toxinXX
6927spinophlin PDZ domainXX
6929NeT3 monomerXX
6933Neurabin PDZXX
6934Wzb monomerXX
6935lipase WTXX
6939USP7 N-terminal domain in complex with an EBNA1 peptideXX
6942myristoylated NCS-1XX
6943chemosensory protein 1XX
6949d2 of RAPXX
6950domain 3 of RAPXX
6951Conotoxin pl14aXX
6952Violacin AXX
6953Major prion proteinXX
696210:0 ACP from spinachXX
6963Second Kunitz domain of human WFIKKN1XX
6965CuA domainXX
6966cytochrome c552XX
6967cytochrome c552XX
6968intrinsically disordered alpha-synucleinXX
6970Rac1.GMPPNP GTPaseXX
6973human p23(1-119)XX
6974human p23(1-160)XX
6975Bcl2MidG4Pu23-G15T G16TXX
6983heme-heme oxygenase-azide complexXX
6984R1a CBD-AXX
6985Hexim1 TBD dimerXX
6986Phosphotyrosine binding domain of chicken tensin 1XX
6987Heme-heme oxygenase-cyanide complexXX
6988HGB1-UBA monomerXX
6989Ribosomal Protein S24EXX
7002Ede1 UBA-ubiquitin complexXX
7004Rpa0253 monomerXX
7005Peptide YYXX
7006Peptide YYXX
7010Merozoite surface protein 1XX
701113-mer peptide from Thermonuclease (E.C.
701218-mer peptide from Thermonuclease (E.C.
7013Bcl-xL dimerXX
7015paramecium calmodulinXX
7020RNA Polymerase II subunitXX
7022DUF589 monomerXX
7023REF2-I double domainXX
7024rabbitpox vCCI:human MIP-1b complexXX
7025VAP-A:OSBP ComplexXX
7033GSPT1/eRF3a(PAM2-2) - PABC complexXX
7035NCK2 2nd SH3XX
7036NCK2 3rd SH3XX
7053cysteine catalytic half-domain of mouse E1 proteinXX
7055PTH monomerXX
7057hbSBD monomerXX
7058MICAL 1 CH monomerXX
7063putative cytoplasmic proteinXX
7064Cycloviolacin O14XX
7071Kis antitoxinXX
7072GOPC PDZ monomerXX
7074Zn-saturated Pf0610XX
7075conserved hypothetical protein pa2412XX
7080NTD-CTD complexXX
7085hypothetical protein yst6499XX
7086hypothetical protein tm1012XX
7088IF2 domain III-IVXX
7089Metalloelastase monomerXX
7091GroES heptamerXX
7097brinker CG9653-PA/DNA ComplexXXX
7101Designed protein TOP7XX
7102Designed Protein AYEXX
7103H98S ARDXX
7104F3 module 2 of NCAMXX
7105SRY.B in complex with 16-mer DNAXXX
7106RGS18 monomerXX
7108TrxA monomerXX
7109TrxA monomerXX
7112FBNYV M-Rep (2-95)XX
7117Hybrid atracotoxinXX
7118Neurabin SAM domain monomerXX
711932324 monomerXX
7120Rho-GTPase-activating protein 7XX
7124B-box2 monomerXX
7125HbCO AXX
7126barnase-barstar complexXX
7129SH3 domainXX
7131IGF2R domain 11XX
7132CheA P1 domainXX
7133CheA P3P4 domainXX
7134brinker CG9653-PAXX
7139free barnaseXX
7140SH2 domain of human CskXX
7141SH2 domain of human Csk with Cbp ligandXX
7142prion proteinXX
7151DLC2-SAM monomerXX
7153Lysozyme LoopXX
71582nd RAN binding zinc finger from hNUP153XX
71592SS[6-127, 30-115]XX
7161Ezrin FERM C ERMAD ComplexXX
7162b' domain of ERp57XX
7166CgNa toxinXX
7167RICH proteinXX
7170sr482 monomerXX
7171tachystatin B1XX
7172C-terminal domain of twinfilinXX
7173tachystatin B2XX
7174Hdm2 RING finger domainXX
7176monomeric antimicrobial peptideXX
7178putative chaperoneXX
7186Spider toxin Magi 5XX
7187Ct ole e 9 monomerXX
7189Cj1258 monomerXX
7191pat90 monomerXX
7194TFIIIA zf46 & 5S rRNA complexXXX
7196DHFR-MTX complexXX
7199DHFR-Bdm-4,6 complexXX
7200DHFR-TMP complexXX
7204KP1966 monomerXX
7206human RNase 7XX
7207human zeta-COPXX
7210Plant HomeoDomain of ING4XX
7211Erabutoxin b monomerXX
7220ephrinB2 ectodomain monomerXX
7221Link TSG6 with and without hyaluronan octasaccharidesXX
7222Link TSG6 without hyaluronan octasaccharidesXX
7223Interferon, alpha-inducible proteinXX
7224Phage-like element PBSX protein xkdWXX
7225UPF0291 protein ynzCXX
7226Conserved protein MTH1368XX
7227Hypothetical protein yppEXX
7228UPF0107 protein AF0055XX
7231Heme-binding protein 1XX
7235beta phosphoglucomutaseXX
7236Mutants Y105W of TEM-1 beta-lactamaseXX
7237Mutants Y105G of TEM-1 beta-lactamaseXX
7238Mutants Y105N of TEM-1 beta-lactamaseXX
7239Mutants Y105D of TEM-1 beta-lactamaseXX
7240scPCNA trimerXX
7244gamma-synuclein monomerXX
7245TM VII of Na+/H+ exchangerXX
7246PEBP2alpha DNA binding domainXX
7247di-Zn(II) DFscXX
7251p53 tetramerization domainXX
7252p53 tetramerization domainXX
7253p53 tetramerization domainXX
7254p53 tetramerization domainXX
7255p53 tetramerization domainXX
7256Hydrogenase-1 operon protein hyaEXX
7257RRM domain of SR rich factor 9G8XX
7259DNA polymerase mu (E.C.
7260YjcQ proteinXX
7261Hypothetical protein ykfFXX
7269fivar docXX
7274Hypothetical protein YdfOXX
7276Blo t 5XX
7277dG85 ttRNHXX
7278iG80b ecRNHXX
7280GB1 domainXX
7281protein yjbR monomerXX
7285double dockerinXX
7288BNIP3 TM dimerXX
7293recoverin bound to rhodopsin kinase fragment (RK25)XX
7294bacillomycin LcXX
7295Synthetic Cyclo Peptide (SCP)XX
7297conserved hypotetical protein RPA1320XX
7298Znf-UBP domain of Ubp-MXX
7300COMMD1 N-terminal domainXX
7305R21A Spc-SH3 monomerXX
7306R21A Spc-SH3 monomerXX
7310cyclophilin DXX
7319polyermase beta in complex with substrate DNAXXX
7321LDLa module of RXFP1XX
7323Colicin immunity protein IM2XX
7326En-1 monomerXX
7339MLP-like protein 28XX
7340DAGK homotrimerXX
7356Rat intestinal fatty acid binding proteinXX
7357Rat intestinal fatty acid binding proteinXX
7359DsbA oxidoreductaseXX
7360DsbA oxidoreductaseXX
7365WW domainXX
7366Periplasmic proteinXX
7381Alr1010 proteinXX
7382Nucleolar protein 3XX
7383Nucleolar protein 3XX
7387PIP 18XX
7390CcV28C AdxL80CXX
7395RWD/GI domainXX
7408HMGB1, ABprimeXX
7409HMGB1, delta5XX
7410HMGB1, delta10XX
7411HMGB1, delta15XX
7412HMGB1, delta20XX
7413HMGB1, delta25XX
7429Phosphotyrosine-Binding Domain of Insulin Receptor Substrate-1 Monomer complex with Interleukin-4 Receptor PhosphopeptideXX
74343F5 PABPN1pept complexXX
7435HVS ORF57/REF2-I complexXX
9500troponin complexXX
100042'-5' RNA ligase-like proteinXX
10005ChiC ChBDXX
10008C-terminal FN3 domain of 1700129L13Rik proteinXX
10009SH3 domain of mouse Kalirin-9a proteinXX
10010bovine beta-lactoglobulin A34C; disulfide linked dimerXX
10011the SWIRM domain of human LSD1XX
10012troponin complexXX
10013ring finger domain of KIAA1045 proteinXX
10014helix6 in SRP RNAXX
10015integrase Zn finger domain mutantXX
10018RNA hairpin of eel LINEXX
10019GSPT1/eRF3a(PAM2-1) - PABC complexXX
10021FoF1 ATP synthaseXX
10022K3 peptide of beta2-microglobulinXX
10025MAP/microtubule affinity-regulating kinase 3XX
10026MAP/microtubule affinity-regulating kinase 3XX
10028the second WW domain of mouse salvador homolog 1 protein (mWW45)XX
10029membrane associated guanylate kinase inverted-2XX
10031KIAA1617 proteinXX
10032KIAA1798 proteinXX
100331700030A21Rik proteinXX
10034KIAA0970 proteinXX
10035Hypothetical protein yk1067a12XX
10036Protein CGI-38XX
10037KIAA1798 proteinXX
10038Zinc finger protein 295XX
10039FYVE, RhoGEF and PH domain containing 6; ethanol decreased 4XX
10040Growth factor receptor-bound protein 7XX
10041MYST histone acetyltransferase 1XX
10042KIAA1068 proteinXX
10043Signal Recoginition Particle 54XX
10044ZF-HD homeobox family proteinXX
10045ZF-HD homeobox family proteinXX
10046Mitogen activated protein kinase kinase 5XX
10047Homeobox leucine zipper protein HomezXX
10048Tudor domain containing protein 3XX
10049Transcription elongation factor S-II protein 3XX
10050NEDD8 ultimate buster-1XX
10052PCP homo tetramerXX
10054UNR proteinXX
10055Glia maturation factor gammaXX
10056regulator of G-protein signaling 14; rap1/rap2 interacting proteinXX
10057nitrogen fixation cluster-likeXX
10058Thioredoxin-like protein 2XX
10059Flotillin 2XX
10060C330018D20rik proteinXX
10061Cypher proteinXX
10063Intersectin 2XX
10065putative nuclear protein homolog 5830484A20RikXX
10066KIAA1526 proteinXX
10067expressed proteinXX
10069actin-binding LIM protein homologueXX
10070Heterogeneous nuclear ribonucleoprotein H'XX
10071RNA-binding protein RalyXX
10072Heterogeneous nuclear ribonucleoproteins C1/C2XX
10073putative elicitor-responsive geneXX
10074synaptotagmin XIIIXX
10075sidekick 2XX
10076sidekick 2XX
10077Eukaryotic translation initiation factor 4BXX
10078LolA monomerXX
10079KIAA0561 proteinXX
10080putative 42-9-9 proteinXX
10081rhophilin, Rho GTPase binding protein 2XX
10082calcipressin 1XX
10083Regulating synaptic membrane exocytosis protein 2XX
10084nuclear distribution gene C homologXX
10085Heterogeneous nuclear ribonucleoprotein HXX
10086Rap guanine nucleotide exchange factor 5XX
1008759 kDa 2'-5'-oligoadenylate synthetase like proteinXX
10088KIAA0147 proteinXX
10089Numb proteinXX
10090hypothetical protein F20O9.120XX
10091Tubulin-folding protein TBCEXX
10092interleukin-1 receptor-associated kinase 4XX
10093Homeobox protein Cux-2XX
10094Homeobox protein Cux-2XX
1009540S ribosomal protein S3XX
10096LolB monomerXX
10097SH3 domain-binding glutamic acid-rich-like protein 3XX
10098Diacylglycerol kinase, deltaXX
10099KIAA1568 ProteinXX
10100Membrane Associated Guanylate Kinase Inverted-2 (MAGI-2)XX
101012610208M17Rik proteinXX
10102KIAA1568 proteinXX
10103KIAA0147 proteinXX
10104polynucleotide kinase 3'-phosphataseXX
10105hypothetical protein RAFL11-05-P19XX
10106hypothetical protein RAFL09-47-K03XX
10107microtubule-associated protein, RP/EB family, member 1XX
10108PDI-like Hypothetical Protein At1g60420XX
10109Glutamate Receptor Interacting Protein 1A-L HomologXX
10110Growth-arrest-specific protein 2XX
10111Nucleolar transcription factor 1XX
10112DNA segment, Chr 7, Wayne State University 128, expressedXX
10113SH2 and PH domain-containing adapter protein APSXX
10114SET binding factor 1XX
10115Oxysterol binding protein-related protein 8XX
10119KIAA0730 proteinXX
10120Lamin AXX
10121immature colon carcinoma transcript 1XX
10122Intersectin 2XX
10123Hepatoma-derived growth factor, related protein 3XX
10125hypothetical protein RIKEN cDNA 2310016K04XX
10126Hypothetical KIAA1002 proteinXX
10127hypothetical PNPaseXX
10128second FNIII domain of DSCAML1 proteinXX
10129sidekick 2 proteinXX
10130NPL4 family proteinXX
10131pleckstrin homology domain-containing, family AXX
10132cytochrome c551XX
10133cytochrome c551XX
10134cytochrome c552XX
10135cytochrome c552XX
10136Intersectin 2XX
10137Lipocalin-type Prostaglandin D synthaseXX
10138Probable 16S rRNA-processing protein rimMXX
10140RimM complexed to S19XX
10141AP-1 complex subunit gamma-2XX
10144Rho GTPase activating protein 5 variantXX
10145Rho GTPase activating protein 5 variantXX
10147Sperm flagellar protein 1XX
10148Protein odd-skipped-related 2XX
10149Protein MICAL-2XX
10150SPCC24B10.08c proteinXX
10151Zinc finger protein 268XX
10152Zinc finger protein 268XX
10153Zinc finger protein 484XX
10154Zinc finger protein 473XX
10155Zinc finger protein 484XX
10156Zinc finger protein 484XX
10157B-cell lymphoma 6 proteinXX
10158Zinc finger protein 473XX
10164Uncharacterized protein C6orf130XX
10165Protein phosphatase 1, regulatory (Inhibitor) subunit 3BXX
10166Zinc finger protein 268XX
10167Zinc finger protein 28 homologXX
10168Zinc finger protein 28 homologXX
10169Zinc finger protein 224XX
10170Zinc finger protein 28 homologXX
10171Zinc finger protein 224XX
10172Zinc finger protein 224XX
10173Zinc finger protein 347XX
10174Zinc finger protein 347XX
10175Zinc finger protein 28 homologXX
10176Zinc finger protein 28 homologXX
10177Zinc finger protein 484XX
10178Zinc finger protein 473XX
10179Zinc finger protein 28 homologXX
10180Zinc finger protein 224XX
10181Zinc finger protein 224XX
10182Zinc finger protein 473XX
10183Zinc finger protein 484XX
10184Zinc finger protein 484XX
10185Zinc finger protein 268XX
10186Zinc finger protein 95 homologXX
10187Zinc finger protein 224XX
10188Zinc finger protein 347XX
10189Zinc finger protein 95 homologXX
10190Zinc finger protein 95 homologXX
10191Zinc finger protein 268XX
10192Zinc finger protein 224XX
10193Zinc finger ZZ-type-containing protein 3XX
10194RUN and TBC1 domain containing 3XX
10196Zinc finger protein 95 homologXX
10197Zinc finger protein 224XX
10198Zinc finger protein 224XX
10199Zinc finger protein 347XX
10200Zinc finger protein 473XX
10201Zinc finger protein 473XX
10202Zinc finger protein 484XX
10203Zinc finger protein 484XX
10204Zinc finger protein 28 homologXX
10205Zinc finger protein 28 homologXX
10206Zinc finger protein 28 homologXX
10207Zinc finger protein 347XX
10208Zinc finger protein 473XX
10209Zinc finger protein 473XX
10210Zinc finger protein 28 homologXX
10211Tyrosine-protein kinase ITK/TSK (E.C.
10213ATP-dependent RNA helicase DDX50 (E.C.3.6.1.-)XX
10214Membrane-associated guanylate kinaseXX
10215Membrane-associated guanylate kinaseXX
10216Zinc finger protein 268XX
10217Zinc finger protein 268XX
10218Zinc finger protein 268XX
10219Zinc finger protein 268XX
10220Zinc finger protein 95 homologXX
10221Zinc finger protein 224XX
10222Zinc finger protein 268XX
10223Zinc finger protein 347XX
10224Zinc finger protein 268XX
10225Zinc finger protein 268XX
10226Zinc finger protein 268XX
10227Zinc finger protein 268XX
10228Zinc finger protein 95 homologXX
10229Zinc finger protein 268XX
10230Zinc finger protein 224XX
10231B-cell lymphoma 6 proteinXX
10232Zinc finger protein 95 homologXX
10233Zinc finger protein 347XX
10234Zinc finger protein 347XX
10235amyloid beta (A4) precursor protein-bindin, family B, member 2XX
10236peptide from Amyloid beta A4 protein, Amyloid beta A4 precursor protein-binding family B member 2XX
10237Amyloid beta A4 precursor protein-binding family B member 2 and Amyloid beta A4 proteinXX
10238Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 2XX
10239Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 2XX
10240cortactin isoform aXX
10241Rho guanine exchange factor (GEF) 16XX
10243Zinc finger protein 24XX
10244Zinc finger protein 462XX
10245Megakaryocyte-associated tyrosine-protein kinaseXX
10246Transcriptional repressor CTCFXX
10247NEDD9 interacting protein with calponin homology and LIM domainsXX
10248HMG-BOX transcription factor BBXXX
10250Signal-transducing adaptor protein 1XX
10251Pleckstrin 2XX
10252thymus high mobility group box protein TOXXX
10253Protein kinase C, D2 typeXX
10254FYVE, RhoGEF and PH domain containing protein 3XX
10255ARAP2 proteinXX
10256Hypothetical protein KIAA1914XX
10257Zinc finger BED domain-containing protein 2XX
10258Ephrin type-B receptor 1XX
10259human unnamed protein productXX
10260Receptor-type tyrosine-protein phosphatase FXX
10261Methionyl-tRNA synthetaseXX
10262Collagen alpha-1(XX) chainXX
10263Receptor-type tyrosine-protein phosphatase FXX
10264signal transducing adaptor molecule 2XX
10265Protein tyrosine phosphatase, receptor type, FXX
10266Receptor-type tyrosine-protein phosphatase FXX
10267PDZ domain-containing protein 1XX
10269Chromodomain helicase-DNA-binding protein 4XX
10271Collagen alpha-1(XX) chainXX
10272SH3 and PX domain-containing protein 2AXX
10273Developmentally-regulated GTP-binding protein 1XX
10274Collagen alpha-1(XX) chainXX
10275PAAD DAPIN, UNP residues 8-88XX
10276Tudor domain-containing protein 3XX
10277Chromobox protein homolog 2 (isoform 2)XX
10278Pleckstrin homology domain-containing protein family B member 1XX
10279Docking protein 2XX
10280Oxysterol binding protein-related protein 11XX
10281Paired box protein Pax6XX
10282FLJ21616 proteinXX
10283Alpha-fetoprotein enhancer binding proteinXX
10284Alpha-fetoprotein enhancer binding proteinXX
10285Alpha-fetoprotein enhancer binding proteinXX
10286Hypothetical protein DKFZp686K21156XX
10287Zinc fingers and homeoboxes protein 3XX
10288Hepatocyte nuclear factor 1-betaXX
10289Zinc finger homeobox protein 1bXX
10290Homeobox protein DLX-5XX
10291Homeobox protein TGIF2LXXX
10292Zinc fingers and homeoboxes protein 2XX
10293LIM/homeobox protein Lhx9XX
10294Homeobox protein OTX2XX
10295Homeobox protein BarH-like 1XX
10296Homeobox protein goosecoidXX
10297Transcription factor 8XX
10298Homeobox and leucine zipper protein HomezXX
10299Tripartite motif protein 9, isoform 2XX
10300Proto-oncogene tyrosine-protein kinase MER precursorXX
10301Crk-like proteinXX
10302SH3-containing GRB2-like protein 2XX
10303Zinc finger protein 28 homologXX
10304Zinc finger protein 95 homologXX
10305Zinc finger protein 347XX
10306B-cell lymphoma 6 proteinXX
10307Zinc finger protein 473XX
10308Zinc finger protein 473XX
10309Zinc finger protein 484XX
10310Zinc finger protein 347XX
10311Pleckstrin homology domain-containing protein family A member 6XX
10312Solution structure of the PH domain of Protein kinase C, nu type from humanXX
10313130-kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating proteinXX
10314Pleckstrin homology domain-containing family B member 2XX
10315Rho GTPase activating protein 21XX
10316TBC1 domain family member 2XX
10317Pleckstrin homology domain-containing family A member 5XX
10318KIAA1075 proteinXX
10319KIAA0640 proteinXX
10327Tripartite motif protein 45XX
10333BK158 1XX
10336Thioredoxin-like protein 1XX
10337Suppressor of T-cell receptor signaling 1XX
10338Ubiquitin carboxyl-terminal hydrolase 5XX
11000ATP Synthase Epsilon ChainXX
11002antimicrobial peptide RP-1XX
11003antimicrobial peptide RP-1XX
11004Ebola fusion peptideXX
11005Bent alpha-helixXX
11009Dm LSm16 monomerXX
11010Rac1/HR1b complexXX
11013dynein heavy chainXX
11017TnpE proteinXX
11018Itk SH3XX
11019Cox17 monomerXX
11022big defensin monomerXX
11024VRAR DNA binding domainXX
11026SHA (single chain polypeptide)XX
11027SH3-F2 (single chain polypeptide)XX
11032the knotted tudor domainXX
11033the presumed chromodomainXX
11038The DNA binding domain of RTBP1XX
11043SHH (single chain polypeptide)XX
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110475'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXXX
11053the West Nile virus NS2B(K96A)-NS3 proteaseXX
11054insect chemokineXX
11055Grb2 SH2XX
11056peptide from V-ATPaseXX
11057the microtubule-binding domain of dynein heavy chain 9XX
11058pituitary adenylate cyclase-activating polypeptide (PACAP)XX
11059pituitary adenylate cyclase-activating polypeptide (PACAP)XX
11062lipocalin-type prostaglandin D synthaseXX
11063Polymyxin b resistant protein DXX
110654.1R FERM alpha-lobe domainXX
11067GIRK1 tetramerXX
110681-23 GBPXX
110691-28 GBPXX
110701-28 GBPXX
11074the F1-ATPase in the F1 complexXX
11076MESD core regionXX
11078Myeloid differentiation primary response protein MyD88XX
11083Acidic leucine-rich nuclear phosphoprotein 32 family member BXX
11085NEDD9 interacting protein with calponin homology and LIM domainsXX
11086Microtubule-associated protein RP/EB family member 3XX
11087Unc-112-related protein 2XX
11089Pleckstrin homology domain-containing family A member 6XX
11090Hydrocephalus-inducing protein homologXX
11091HYDIN proteinXX
11092Mortality factor 4-like protein 1XX
11093Tyrosine-protein kinase ITK/TSK (E.C.
11094Fibroblast growth factor receptor substrate 3, ALK tyrosine kinase receptorXX
11095Fibroblast growth factor receptor substrate 3 and ALK tyrosine kinase receptorXX
11096Netrin receptor DCCXX
11097Netrin receptor DCCXX
11098Netrin receptor DCCXX
11099Netrin receptor DCCXX
11100Protein disulfide-isomerase A6XX
11101Protein disulfide-isomerase A4XX
11102Protein disulfide-isomerase A3XX
11103Netrin receptor DCCXX
11104Protein disulfide-isomerase A4XX
11105Thioredoxin-related transmembrane protein 2XX
11106midline 2 isoform 2XX
11107Thioredoxin domain-containing protein 5XX
11108Thioredoxin-like protein 2XX
11109Protein disulfide-isomerase A4XX
11113Thioredoxin domain containing protein 1XX
11114Protein disulfide-isomeraseXX
11115Complex structure of the zf-CW domain and the H3K4me3 peptideXX
11116Protein disulfide-isomerase A6XX
11117Ephrin type-A receptor 1XX
11122Smooth muscle cell associated protein-1, isoform 2XX
11123SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1XX
11124Calponin 1XX
11125Fibronectin type-III domain containing protein 3aXX
11126Spectrin beta chain, brain 2XX
11127biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding proteinXX
11128biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding proteinXX
11129Rho guanine nucleotide exchange factor 6XX
11130Zinc finger protein 512XX
11131Zinc finger, FYVE domain containing 27 isoform bXX
11132novel proteinXX
11134WD repeat and HMG-box DNA binding protein 1XX
11141Vav-3 proteinXX
11142Smoothelin splice isoform L2XX
11143Protein MICAL-3XX
11144Williams-Beuren syndrome chromosome region 18 proteinXX
11145EHBP1 proteinXX
11146Eukaryotic translation initiation factor 5XX
11147High mobility group protein B1XX
11148Nuclear factor of activated T-cells, cytoplasmic 4XX
11150Ectonucleotide pyrophosphatase/phosphodiesterase family member 1XX
11151Protein kinase C delta typeXX
11152Integrin beta-4XX
11153130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating proteinXX
11154Sorbin and SH3 domain-containing protein 1XX
11155Abl interactor 2XX
11157Cytoplasmic tyrosine-protein kinase BMXXX
11158Transcription factor SOX-17XX
11159Retinoblastoma-binding protein 6XX
11160Myeloid/lymphoid or mixed-lineage leukemia protein 3 homologXX
11161Tripartite motif-containing protein 30XX
11162RING finger protein 126XX
11163Tripartite motif-containing protein 5XX
11164TNF receptor-associated factor 3XX
11165Zinc finger protein 268XX
11166Zinc finger protein 268XX
11167Zinc finger protein 347XX
11168Zinc finger protein 347XX
11169Zinc finger protein 484XX
11170Zinc finger protein 484XX
11171Zinc finger protein 484XX
11173Ubiquitin carboxyl-terminal hydrolase 5XX
11178Olygophrenin-1 like proteinXX
11179SH3-domain kinase binding protein 1XX
11180RIM binding protein 2XX
11181KIAA1496 proteinXX
11182Regulating synaptic membrane exocytosis protein 1XX
11183RIM binding protein 2XX
11184RIM binding protein 2XX
11185RIM binding protein 2XX
11186InaD-like proteinXX
11187InaD-like proteinXX
11188InaD-like proteinXX
11189InaD-like proteinXX
11190InaD-like proteinXX
11191InaD-like proteinXX
11192Myosin binding protein C, fast-typeXX
11193SH3 and PX domain-containing protein 2AXX
11194SH3 and PX domain-containing protein 2AXX
11195Rho guanine nucleotide exchange factor 11XX
11196Uncharacterized protein KIAA1666XX
11197InaD-like proteinXX
11198synapse-associated protein 102XX
11199Enigma homologue proteinXX
11200MAGUK p55 subfamily member 5XX
11201KIAA1095 proteinXX
11203Calcyclin-binding proteinXX
11205Zinc finger protein 435XX
11206Glutamate receptor interacting protein 2XX
11207LAP4 proteinXX
11208Ephrin type-A receptor 8XX
11209SH3 domain GRB2-like protein B1XX
11210amyloid beta (A4) precursor protein-binding, family A, member 1 (X11)XX
11211Myosin-binding protein C, slow-typeXX
11212Myosin-binding protein C, slow-typeXX
11213SH3YL1 proteinXX
11214SH3 domain of Fyn-related kinaseXX
11215T-cell lymphoma invasion and metastasis 1 variantXX
11216PDZ domain containing protein 1XX
11217SH3 domain of Stac proteinXX
11218CIDE-N domain of human cell death activator CIDE-AXX
11219Sorbin and SH3 domain-containing protein 1XX
11220second SH3 domain of human KIAA0769 proteinXX
11221Ig-like domain of Obscurin-like protein 1XX
11222first SH3 domain of human KIAA0769 proteinXX
11223Leucine-rich repeat-containing protein 4XX
11224Phospholipase C, gamma 2XX
11225SLIT-ROBO Rho GTPase-activating protein 2XX
11226MAGUK p55 subfamily member 2XX
11227Ephrin type-B receptor 4XX
11228Rho guanine nucleotide exchange factor 9XX
11229Obscurin-like protein 1XX
11231KIAA1837 proteinXX
11232Protein KIAA0319XX
11233KIAA1783 proteinXX
11234Tripartite motif-containing protein 31XX
11235Myosin-binding protein C, fast-typeXX
11236Myosin light chain kinase, smooth muscleXX
11237Myeloid/lymphoid or mixed-lineage leukemia protein 3 homologXX
11238Zinc finger protein 473XX
11239Zinc finger protein 473XX
11240Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrialXX
11244Nuclear receptor corepressor 1XX
11245ubiquitin-like 5XX
11246Afadin 6XX
11247Ubiquitin ligase protein RNF8XX
11248LIM domain kinase 2XX
11249holo GrxS14XX
11251Zinc finger FYVE domain-containing protein 21XX
11252HRDC domain from Bloom syndrome proteinXX
112531700011N24Rik proteinXX
11254cytoskeleton-associated protein 1XX
11255Nuclear receptor coactivator 5XX
11256Ubiquitin carboxyl-terminal hydrolase 14XX
11257ubiquitin-like 3XX
11258RIKEN cDNA 2900073H19 proteinXX
11259Toll-interacting proteinXX
11260ubiquitin associated proteinXX
11261Ubiquilin 3XX
11262RIKEN cDNA 4931431F19XX
11263HLA-B associated transcript-3 isoform bXX
11265A-Raf proto-oncogene serine/threonine-protein kinaseXX
11266Np95-like ring finger protein, isoform aXX
11267Ubiquitin-like protein SMT3BXX
11268Ubiquitin-like protein SB132XX
11269KIAA0733 proteinXX
11270FLJ35834 proteinXX
11272KIAA0977 proteinXX
11273Protein KIAA0794XX
11274ETEA proteinXX
11275poly (ADP-ribose) polymerase family, member 10 variantXX
11276CUE domain-containing protein 1XX
11277Rap guanine nucleotide exchange factor (GEF)-like 1XX
11278Activating signal cointegrator 1 complex subunit 2XX
11279Ubiquitin-like protein 4AXX
11280Synaptic glycoprotein SC2XX
11281UBX domain-containing protein 2XX
11282Protein FAM100BXX
11283FAS-associated factor 1XX
11284Hypothetical protein FLJ21522XX
11285peroxisomal biogenesis factor 13XX
11286Synapse associated protein 1XX
11287Zinc finger protein 292XX
11288Fibronectin type-III domain containing protein 3aXX
11290Fibronectin type-III domain containing protein 3aXX
11291myosin binding protein C, fast-typeXX
11292Receptor-type tyrosine-protein phosphatase deltaXX
11293Cysteine-rich protein 2XX
11294RWD domain containing protein 2XX
11295Protein C21orf6XX
11296RING finger protein 25XX
11297Lamin-B receptorXX
11298TFIIH basal transcription factor complex p62 subunitXX
11299Proline-serine-threonine phosphatase-interacting protein 1XX
11300Cell division cycle 5-like proteinXX
11301Cell division cycle 5-like proteinXX
11302Zinc finger protein 64, isoforms 1 and 2XX
11303RING finger protein 25XX
11304Neural cell adhesion molecule 2XX
11305Actin Binding LIM Protein 2XX
11306Deltex protein 2XX
11307KIAA0161 proteinXX
11308Protein arginine N-methyltransferase 3XX
11309Cell growth regulating nucleolar protein LYARXX
11310phosphoacetylglucosamine mutaseXX
11311Transforming growth factor-beta induced protein IG-H3XX
11312Zinc finger protein 64, isoforms 1XX
11313Zinc finger protein 183-like 1XX
11314Synaptotagmin-like protein 4XX
11315Non-SMC element 1 homologXX
11316Transcriptional repressor CTCFXX
11317Tripartite motif protein 32XX
11318Cdc42-interacting protein 4XX
11319Zinc finger BED domain containing protein 1XX
11320sh3 domain-binding glutamic acid-rich-like protein 2XX
11321RING finger protein 31XX
11322KIAA1915 proteinXX
11323Zinc finger MYND domain containing protein 10XX
11324THAP domain-containing protein 2XX
11325cellular modulator of immune recognitionXX
11326RING finger protein 146XX
11327Ubiquitin ligase TRIM63XX
11328Zinc finger FYVE domain-containing protein 19XX
11329Possible global transcription activator SNF2L2XX
11330Paf1/RNA polymerase II complex componentXX
11332Polycomb group RING finger protein 6XX
11333RING finger and CHY zinc finger domain-containing protein 1XX
11334PHD finger protein 3XX
11335Cell growth regulator with RING finger domain protein 1XX
11336RING finger protein 4XX
11337RWD domain-containing protein 3XX
11338RWD domain-containing protein 1XX
11339Baculoviral IAP repeat-containing protein 4XX
11340TNF receptor-associated factor 6XX
11341Tripartite motif-containing protein 39XX
11342RING-box protein 2XX
11343RING finger and CHY zinc finger domain-containing protein 1XX
11344RING finger protein 141XX
11345Transcriptional adapter 2XX
11346Tumor necrosis factor receptor superfamily member 12AXX
11347PHD finger protein 21AXX
11348KIAA1787 proteinXX
11349Skeletal muscle LIM-protein 3XX
11350Skeletal muscle LIM-protein 3XX
11351Protein neuralizedXX
11352inhibitor of growth family, member 1-likeXX
11353Inhibitor of growth protein 3XX
11354inhibitor of growth family, member 4 ING1-like proteinXX
11355Pre-mRNA-splicing factor 18XX
11356Rho guanine nucleotide exchange factor 6XX
11357Transcription elongation regulator 1XX
11358Zinc finger CW-type PWWP domain protein 1XX
11359Zinc finger CW-type PWWP domain protein 1XX
11360Zinc finger CW-type PWWP domain protein 1XX
11361Zinc finger CW-type PWWP domain protein 1XX
11362Zinc finger CW-type PWWP domain protein 1XX
11363Zinc finger HIT domain containing protein 2XX
11364Splicing factor 3 subunit 1XX
11366spliceosomal protein complex p14-SF3b155XX
11367spliceosomal protein SF3b155XX
11368Zinc finger protein 95 homologXX
11369Zinc finger protein 224XX
11370Tia1 proteinXX
11371Tia1 proteinXX
11372Tia1 proteinXX
11373Tia1 proteinXX
11374Tia1 proteinXXX
11375Tia1 proteinXXX
11376Tia1 proteinXX
11377POZ-, AT hook-, and zinc finger-containing protein 1XX
11378POZ-, AT hook-, and zinc finger-containing protein 1XX
11379POZ-, AT hook-, and zinc finger-containing protein 1XX
11380POZ-, AT hook-, and zinc finger-containing protein 1XX
11381Zinc finger protein 32XX
11382Zinc finger protein 32XX
11383Zinc finger protein 268XX
11384Zinc finger protein 268XX
11385Zinc finger protein 28 homologXX
11386Zinc finger protein 347XX
11387Zinc finger protein 347XX
11388Jumonji, AT rich interactive domain 1BXX
11389Jumonji/ARID domain-containing protein 1DXX
11391Zinc finger protein 268XX
11392Zinc finger protein 28 homologXX
11393Zinc finger protein 347XX
11394Zinc finger protein 347XX
11395Zinc finger protein 224XX
11396Zinc finger protein 484XX
11397Kelch repeat and BTB domain-containing protein 4XX
11399PTB-like protein LXX
11400Arginine/serine-rich splicing factor 10XX
11401Protein kinase C gamma typeXX
11402Chromodomain-helicase-DNA-binding protein 6XX
11403Zinc finger protein 32XX
11404Rho GTPase-activating protein 4XX
11405CUG-BP- and ETR-3-like factor 1XX
11406CUG-BP- and ETR-3-like factor 1XXX
11407CUG-BP- and ETR-3-like factor 1XXX
11408CUG-BP- and ETR-3-like factor 1/RNA ComplexXXX
11409cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11410cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11411cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11412cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXXX
11413cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) geneXX
11414zinc finger-containing protein 1XX
11415Zinc finger protein 32XX
11416Zinc finger protein 32XX
11417DnaJ homolog subfamily B member 8XX
11419vasoactive intestinal peptideXX
11420Vasoactive intestinal peptideXX
11422CTP pyrophosphohydrolaseXX
11423Flagellar hook-length control proteinXX
11424tight junction protein ZO-1XX
11425SPFH domain of human stomatinXX
11426Probable SecDF protein-export membrane proteinXX
11429HMGB2 A-domainXX
11430HMGB2 B-domainXX
11431HMGB2 B-domain (H22Y)XX
11434Ostrich egg white lysozymeXX
11436E73A mutant of Ostrich egg white lysozymeXX
11441Bryum coronatum chitinaseXX
11442Hd3a (K31A/E57A)XX
11450RNA-binding protein Musashi homolog 1XXX
11451peptidyl-prolyl cis-trans isomeraseXX
11454QB domain of Sp1XX
11466Bryum coronatum chitinase E61A mutantXX
11467Family GH19 chitinase from Rye seedsXX
11471FKBP12-mTOR FRB domain-rapamycin complex structureXX
11472WWE domain in RNF146 with ATPXX
11473CERT PH domainXX
11489RNA aptamer against prion proteinXXX
11490Microtubule-binding domainXX
11493Streptomyce sp. N174 chitosanaseXX
11494E22A mutant of Streptomyces sp. N174 chitosanaseXX
11495Microtubule-binding domainXX
11496the chromodomain of Chp1 in complex with H3K9me3 peptideXX
11497the chromodomain of Swi6XX
11498Unique and SH3 domains of mouse LckXX
11500PARP11 WWE domainXX
11504SPOC domain of the human transcriptional corepressor SHARP in complex with SMRTXX
11506human full-length vaccinia related kinase 1 (VRK1)XX
11507an inhibitor protein of DL-endopeptidasesXX
11511structure specific recognition protein 1XX
11513C1 domainXX
11515goat alpha-lactalbuminXX
11522the monomeric human M-ficolin fibrinogen-like domainXX
11523the second RRM domain of Nrd1XX
11525PriC N-temrinal domainXX
11527PriB homodimerXX
11529a regulatory domain of meiosis inhibitorXX
11530chitin binding domain1XX
11541Protein-RNA ComplexXXX
11542yeast Tim50 PBDXX
11555the YAM domain of E. coli Transporter YajRXX
11556DHFR (G67V)-FolateXX
11561a' domain of Protein Disulfide Isomerase (oxidized form)XX
11562a' domain of Protein Disulfide Isomerase (reduced form)XX
11564RPEL motif of rat MKL1 proteinXX
1156594P-RPEL motif of rat MKL1 proteinXX
11566L105P-RPEL motif of rat MKL1XX
11567RPEL motif of rat MKL1 proteinXX
11568RPEL motif of rat MKL1 proteinXX
11570SrtA AX bocLPATXX
11578complex between p53 transactivation domain 2 and TFIIH p62 PH domainXX
11580Fusion peptide in DPC micellesXX
11581Pre transmembrane domain in DPC micellesXX
11582Internal fusion peptide in DPC micellesXX
11583P2XHD monomerXX
11584c-Myb R2R3 C130IXX
11585c-Myb R2R3 V103L/C130IXX
11587Human Pin PPIase C113A mutantXX
11588Human Pin1 PPIase C113S mutantXX
11591chitosan-binding module 1XX
11592chitosan-binding module 2XX
11594The Acidic String of the Nucleotide Excision Repair Factor XPCXX
11595Zalpha domainXX
11596gallium ferredoxinXX
11607Reverse transcriptase recognition site of transcript of a LINE from Denio Renio, LS-1XX
11609histone H2A-H2B heterodimerXX
12002second LysM domain from Volvox carteri chitinaseXX
12003neuronal SNARE complexXX
12010flagellar protein FliGcXX
12011flagellar protein FliGc A282TXX
12014TvCyP1 homodimerXX
12018YAP-binding domain of transcription factor TEAD4XX
12019chitin-binding domain of chitinase A1XX
12020wild-type SPINK1XX
12022sublancin 168 peptide moietyXX
12024cellulosomal double-dockerinXX
12026NZF domain in linear di-ubiquitin-bound formXX
12032NS1 effector domainXX
12040Rpn12 246XX
15002CtBP THAP domainXX
15003PinA WW domainXX
15007msp-1 c-terminal domainXX
15013SPCp41 monomerXX
15014hTraf6 2ZnXX
15016WW4 - peptide complexXX
15019DAGK homotrimerXX
15031alpha-conotoxin BuIAXX
15034YFED3 monomerXX
15037human beta-microseminoproteinXX
15039Chain 1XX
1504013-mer analogue of Prophenin-1 containing WWWXX
1504113-mer analogue of Prophenin-1 containing WWWXX
15045BBP+EF in DHPC micellesXX
15046Subunit F of the A1AO ATP synthase from Methanosarcina mazei Go1XX
15047denatured ubiquitinXX
15049PCBP2 KH1+KH2XX
15055N-term of dnaAXX
15058En-6 monomerXX
15060monomeric DLC2 SAM domainXX
15061intein precursor polypeptideXX
15063ThTPase mouseXX
15070heme oxygenaseXX
15074IBR domain of ParkinXX
15076LC8 dimerXX
15077LC8 / Swa complexXX
15078LC8 / IC complexXX
15080Yeast U2 stem IXX
15081Human U2 Stem IXX
15082Rat intestinal fatty acid binding proteinXX
15084CDA-BABP complexXX
15085RP4601 assemblyXX
15086hypothetical protein Cgl2762XX
15090str109 homodimerXX
15092single polypeptideXX
15095Alpha-Syn12 bound with Synphilin-1XX
15100YfgJ with Zn+2XX
15109CPH domainXX
15113NC:muPsi complexXXX
15117NS1A:dsRNA complexXXX
15118YW12 monomerXX
15120MMP3 complexed with NNGHXX
15124Complex of VIR165 and FP1-23XX
15128RGS domain from human RGS14 proteinXX
15132Top7 monomerXX
15133Uncharacterized BCRXX
15134phl p 3XX
15141TC-1 monomerXX
15142DL2A homodimerXX
15144SH3 monomerXX
15148HMGB1 AB boxes + basic tailXX
15149HMGB1 Full LengthXX
15154protein-peptide complexXX
15157Duck HBV epsilon apical tetraloopXX
15160polymerase eta UBZ domainXX
15163LARG PDZ domain complexXX
15168LARG PDZ domainXX
15180Spinophilin PP1 binding domainXX
15192alphaC-Domain FragmentXX
15198all-Ala-hen egg white lysozymeXX
15200ApoORP monomerXX
15201denatured OmpXXX
15203CPE0013 monomerXX
15204huamn IgG1 CH3 domainXX
15206Needle MonomerXX
15209hDlg PDZ2/E6 complexXX
1521050s ribosomal protein l14eXX
15211protein yxeFXX
15212RRM1 domainXX
15213IntCB-DNA complexXXX
15217YKVR MonomerXX
15218ATWLPPR heptapeptideXX
15219RXRalpha LBD ternary complexXX
15223AB G alphaXX
15224AB G betaXX
15225Domain 2 of Non-structural Protein 5A (NS5AD2)XX
15228duplex DNA containing an abasic site with opposite T (beta anomer)XX
15238Ab C alphaXX
15239Ab C betaXX
15240ERCC1 centralXX
15242a single polypeptide chainXX
15243TCTP monomerXX
15245villin G34L monomerXX
15248Subtilisin bound to prodomainR9XX
15249Cyclic Nucleotide Binding Domain (CNBD) in Complex with cAMPXX
15253dihydrofolate reductase with folate boundXX
15257RsmE dimer with two RNA stem loopsXXX
15265Orf c02003 proteinXX
15267PW2 in DPC micellesXX
15271SMB domain from vitronectinXX
15272M cono-toxin mr12XX
15273conopeptide mr12 mutantXX
15275srp54 of archaeoglobus fulgiusXX
15288YobA 21-120XX
15289THAP domainXX
15300THAP domainXX
15301CcV28C AdxL80CXX
15303bb-PDI monomerXX
15304ExbD periplasmic domainXX
15305cardiotoxin A3XX
15309cardiotoxin A5XX
15317CPS 2611XX
15320UPF0350 protein VC 2471XX
15324RPA2121 doamin-swapped dimerXX
15333Pirh2 RING domainXX
15336single polypeptide chainXX
15338YfgJ monomerXX
15339Ribosome Modulation FactorXX
15340CFTR Regulatory RegionXX
15341full length SiR90XX
15346YejL homodimerXX
15349Nck1-2 SH3XX
15350sr478 dimerXX
15351Nck1-1 SH3XX
15352rpt8 dimerXX
15354NMR Structure of protein Q60C73 METCAXX
15357SNase complexXX
15359arenicin monomerXX
15369ribosome-inactivating proteins (RIP)XX
15370apd monomerXX
15371antimicrobial resistance proteinXX
15372TCI monomerXX
15379Sup35 NM domainXX
15383ClpC N-domainXX
153844HB homodimerXX
15385F104W cTnCXX
15388F153W cTnCXX
15390HA Fusion Domain Mutant F9AXX
15391KIA7 peptide tetramerXX
15392KIA7F peptide tetramerXX
15400F153(FTR) cTnCXX
15404CBP homodimerXX
15407CD2AP SH3-C monomerXX
15411Single polypeptide chainXX
15422KChIP4a monomerXX
15423a single polypeptide chainXX
15427F104(FTR) cTnCXX
15437S836 monomerXX
15444DNA binding domain of NgTRF1 monomerXX
15449ACP domain from ratXX
15451OST domain in GABP alphaXX
15452profilin IIXX
15462HI0947 HomodimerXX
15464Human Insulin MonomerXX
15466PinA WW domainXX
15471Peptidyl-tRNA hydrolase domain proteinXX
15474Unfolded apoflavodoxinXX
15481HOMER3A EVH1 domainXX
15504MxiM - MxiD complexXX
15506Colicin N T domainXX
15507Mip-rapamycin complexXX
15511C-terminal dimerization domain of SARS coronavirus nucleocapsid proteinXX
15512Palladin Ig3 domainXX
15513VpU polypeptideXX
15514human IgG1 FcXX
15515daptomycin in DHPCXX
15518GW1929-PPARgamma Ligand-Binding Domain ComplexXX
15534c-Cbl UBAXX
15539DUF683 tetramerXX
15540C-terminal chromo domainXX
15543rna bound nelfe-rrmXXX
15544YW12D SDSXX
15548stefin BXX
15550hPCIF1 WW domain monomerXX
15552beta3 integrinXX
15553Gal lectinXX
15557ADF monomerXX
15558fat globule-EGF-factor 8-LXX
15560RecA miniInteinXX
15562Ymr074cp (1-116) monomerXX
15567PDZ domainXX
15573Protein LXXX
15576NFATC2IP Ubh monomerXX
15587ubiquitin-related modifierXX
15589Sperm Whale apoMb(1-77) complex with DnaK-betaXX
15591P62 UBAXX
15592P62 UBA in complex with ubiquitinXX
15594calbindin with Yb3+XX
15596Human macrophage inflammatory protein 3alphaXX
15602domain C of human PARP-1XX
15604SgR42 proteinXX
15611ewr120 proteinXX
15612Inner-linker peptide from PDHXX
15620single polypeptide chainXX
15621single polypeptide chainXX
15622antilipopolysaccharide factorXX
15626yeast ARF1 monomerXX
15629complex pyoverdine PvdI-Ga(III)XX
15632TCS C-domainXX
15634FeoC monomerXX
15635CXCL12/SDF1-alpha, CXCR4XX
15636CXCL12/SDF1-alpha, CXCR4XX
15637CXCL12/SDF1-alpha, CXCR4XX
15638Rv1567c monomerXX
15645Im7 mutantXX
15651KpOmpA transmembrane domainXX
15653Vinculin TailXX
15654Insulin-like growth factor-I (IGF-I)XX
15656Duck HBV apical loopXX
15663CaBP3 monomerXX
15666Im7 mutantXX
15669PH domain of GRP1XX
15672p12CAN monomerXX
15674chromobox protein homolog 7XX
15676prion proteinXX
15677water-soluble analogue of KcsAXX
15680Phosphatase domain of PTPN7XX
15690protein complex MNK1-Cu(I)-HAH1XX
15693Pax8 paired Box DomainXX
15695chromobox protein homolog 4XX
15698Lethocerus F1 troponin C isoformXX
15700human N-termal doamin of pirh2XX
15701human C-termal doamin of pirh2XX
15706DFP inhibited mature subtilisin EXX
15707split PH domain from Phospholipase C gamma 2XX
15719calponin monomerXX
15720Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein familyXX
15722Ca2+ bound Collagen binding domain derived from Clostridium HistolyticumXX
15724Flavodoxin oxidizedXX
15725Flavodoxin oxidizedXX
15726La NTD apoXX
15727La NTD complexed with 5'UUUUXXX
15728EphA1 TM dimerXX
15729Tick Carboxypeptidase InhibitorXX
15730intermediate IIIa of Tick Carboxypeptidase InhibitorXX
15731Tick Carboxypeptidase InhibitorXX
15733chicken Lamin B ReceptorXX
15736Full-length Human frataxin monomerXX
15737AcrA(61-210DD) glycosylatedXXX
15740protein K7 from the Vaccinia virusXX
15744Lipid-free human apolipoprotein EXX
15746BPP3783 115-120XX
15747TMIX peptideXX
15748D,L-Peptide FoldamersXX
15749D,L-Peptide FoldamersXX
15752ILTat1.24 C2 domainXX
15753ILTat1.24 C1 domainXX
15763Human Mia40XX
15765Tetraheme Cytochrome from Shewanella FrigidimarinaXX
15767HCV-C82 monomerXX
15768HCV-C82 monomerXX
15773Human ProlactinXX
15775The transmembrane C-terminal domain of the Amyloid Precursor ProteinXX
15784NikA(1-51) homodimerXX
15788Ferredoxin-NADP ReductaseXX
15789Ca-bound MCFD2XX
15798Tpx monomerXX
15799HIV-1 Gag p6ctXX
15803RalB-RLIP complexXX
15804TR8 proteinXX
15808alpha-Actinin4 CH2 domainXX
15809myr-yARF1.GDP, monomerXX
15812FeoA-like proteinXX
15814Domain 5 of Dictyostelium ABP-120XX
15820RRM1 of hnRNPLLXX
15824Prion ProteinXX
15834FeoA proteinXX
15841Protein FeoAXX
15845Prion ProteinXX
15848YhhK CoAXX
15851Stromal interaction molecule 1XX
15863EAS D15XX
15866CIN85 Sh3-C domain/ubiquitin complexXX
15867GED monomerXX
15868GED monomerXX
15870H1-47 subunit A ATP synthaseXX
15875Nudix hydrolaseXX
15877LC3/p62 complexXX
15882SPF45 UHM domainXX
15885UHM domain of Puf60XX
15887minimal complex of Puf60 and U2AF65XX
15888minimal complex of Puf60 and SF1XX
15889minimal complex of Puf60 and SF1XX
15890minimal complex of Puf60 and SF3b155(317-357)XX
15891minimal complex of Puf60 and Prp16(201-238)XX
15899C-terminal CH domain of alpha-parvin monomerXX
15903Rv0008c monomerXX
15904Flavodoxin oxidizedXX
15905Ribonuclease T1XX
15912Itk SH3 and Itk SH2 domainsXX
15914Binder of Arl2XX
15919RAP74/FCP1 complexXX
15923rat S100BXX
15928ARNT PAS-B Slipped IB StrandXX
159304 sigma70XX
15934M-crystallin in 6M Gdn-HClXX
15935Pfu RPP29d17-RPP21V14 complexXX
159364 sigma70XX
15940Saccharomyces cerevisiae V(1)V(O) ATPaseXX
15942RRM2 monomerXX
15945MDM2 N-terminal domain, residues 17-125XX
15948RING Finger monomerXX
15949PRL-1 C170-171S monomerXX
15950E.Coli SlyDXX
15953H55K mutant of LC8XX
15959Phosphotyrosine-Binding Domain of Insulin Receptor Substrate-1 MonomerXX
15962HasAp truncated polypeptideXX
15963HasAp Full-Length polypeptideXX
15965TM1b(1-19)Zip/TM9d252-284 complexXX
15967IscU-HscB complexXX
15972Mast205 monomerXX
159754 sigma70XX
1598689FnI-collagen complexXX
15990RNAP monomerXX
15991Core Binding DomainXX
15999HTH 3XX
16005EphA2 TM dimerXX
16009NpuDnaE inteinXX
16010bovine pancreas ribonuclease AXX
16011bovine pancreas ribonuclease AXX
16014TAZ1/STAT2 complexXX
16015TAZ2/STAT1 complexXX
16020M2 Transmembrane PeptideXX
16022KIA7W tetramerXX
16023KIA7H tetramerXX
16032NaV1.2 C-terminal EF-hand domainXX
16037BlrP1 BLUFXX
16040onconase C87A/C104AXX
16052STAS domain of Rv1739c, a putative sulfate transporter of Mycobacterium tuberculosisXX
16065RelE:RelBc complexXX
16070Pin1 WWXX
16077mPrP90 P105LXX
16078mPrP90 A117VXX
16079mPrP90 3AVXX
16080mPrP90 3AVXX
16084SRU 0103XX
16085ACP single polypeptide chainXX
16088Pin1 WWXX
16093SRU 2040XX
16098Apo-form YjaBXX
16100DR A0006XX
16103FAIM-CTD monomerXX
16108single polypeptideXX
16109Herpud2 9 85XX
16111Art v 1- the major allergen of Artemisia vulgarisXX
16121L14e ribosomal proteinXX
16122HCV NS4B(227-254)XX
16127SAP30 ZnFXX
16130Tdom 40-76 TolAIII complexXX
16136jerdostatin polypeptideXX
16141HACS1 SH3 domainXX
16150jerdostatin R24KXX
16151jerdostatin -N45G46 polypeptideXX
16152jerdostatin R24K -N45G46 polypeptideXX
16158beta1D integrin tailXX
16159beta1A integrin tailXX
16160MYPT1 1-98 monomerXX
16162beta1D integrin tailXX
16167FXYD4 monomer in micellesXX
16174Rv0287-Rv0288 complexXX
16177E73 HomodimerXX
16183Tammar Wallaby Prion Protein (121-230)XX
16184Mouse Prion Protein (121-231)XX
16185Mouse Prion Protein (121-231)XX
16186PSPTO 3016XX
16190cNTnC and WW7XX
16209JARID1A PHD finger 3XX
16210JARID1A PHD finger 3XX
16214Zn finger protein YBILXX
16217apoMb(1-119) fragment in the presence of DnaK-betaXX
16218apoMb(1-119) fragmentXX
16221CBD monomer of MMP2XX
162291H, 13C, and 15N Chemical Shift Assignments for ring1B C terminal domain/ cbx7 CBOX complexXX
16230U6 snRNP (small fragment)XXX
16231Pathogen Recognition Domain from Plodia interpunctellaXX
16236Bruno RRM3+XX
16238VC A0919XX
16239Plantaricin JXX
16241Plantaricin JXX
16244U6 snRNP (fragment)XXX
16247F1Fo ATP synthaseXX
16248PknB-phosphorylated Rv1827XX
16249NR3 dimerXX
16250human intersectin-1XX
16251syr103b proteinXX
16257Nogo66 in pH 4.0XX
16259beta7 integrin tailXX
16263NLRP7 Pyd monomerXX
16265N-terminal domain monomerXX
16267tungsten formylmethanofuran dehydrogenase subunit DXX
16268cannabinoid receptor-2 helix 6XX
16270Sortase A-substrate complexXX
16271OCRL bridges clathrin-mediated membraneXX
16273OCRL bridges clathrin-mediated membraneXX
16279Hsp90 middle domainXX
162811:1 complexXX
162872:1 complexXX
162881:2 complexXX
162901:1 complexXX
162912:1 complexXX
162922:1 complexXX
16293CA150 FF1+linkerXX
16297AIDA-1 SAM domain tandemXX
16299T1 domain tetramerXX
16306Truncated hemoglobinXX
16307Truncated hemoglobinXX
16311VEK-30/plasminogen kringle 2 complexXX
16312mul A0064NXX
16315putative phage integrase IntSXX
16316IntB phage-integrase-like proteinXX
16317human interleukin-33XX
16318CBP TAZ2/Adenoviral E1A ComplexXX
16319Carnocyclin AXX
16329DsbA monomerXX
16330DsbA monomerXX
16334nonmyristoylated NCS1XX
16337Complex of APH with antibiotic tobramycinXX
16340calcium-loaded Calbindin D9K P43GXX
16345permutant P54-55XX
16349Tyrosine-protein kinase ABL2XX
16350pheromone En-A1XX
16353Proto-oncogene tyrosine-protein kinase FERXX
16354A1AO ATP synthaseXX
16359NS2B NS3proXX
16360S100A1 (aa) dimerXX
16361p62 PB1XX
16367CFTR NBD1-RE monomerXX
16370Human MyotilinXX
16386Human Fibulin-4XX
16390ubiquilin 1XX
16393CFTR NBD1-RE monomerXX
16394deltaF508 CFTR NBD1-RE monomerXX
16395M.HhaI-DNA-cofactor ternary complexXX
16397human ataxin-7XX
16399W4W9 MonomerXX
16402human Ataxin-7-L3XX
16407W2W11 MonomerXX
16411Rtt103 CTD interacting domainXX
16412Rtt103 bound to CTD peptideXX
16415ns-LTP-DMPG complexXX
16416HIV-PR(D25N)-substrate C complexXX
16417AfaE-dsc DAF1234 complexXX
16418apoCaM-IQ peptideXX
16420Fyn SH3 GuHCl complexXX
16421Chagasin/cruzipain complexXX
16422C16PN/NRho complexXX
16423protein:ligand complexXX
16426murine Ets-1XX
16439factor H (modules 10-15)XX
16443cytochrome c3XX
16453LMW-PTP DimerXX
16455Gall5Glc/Peptide 2XX
16458cL-BABP GCDA complexXX
16459Ran BD2/Ran C complexXX
16460MutS nucleotide complexXX
16461VPR dimerXX
16462Sem-5 Sos peptide complexXX
16467AML1-ETO/HEB peptide complexXX
16469Ribonuclease T1XX
16470ShcA PTB domain-NPLH peptideXX
16471IQGAP1 (401-533)XX
16475LpxC-L-161,240 complexXX
16477e1 peptideXX
16481pfLamA (50% Ca2+)XX
16483CR17 from LRP-1 and ApoEXX
16486GTP pyrophosphokinaseXX
16498CLOLEP 01837XX
16503RNase AXX
16504Human cannabinoid receptor 1 - helix 7/8 peptideXX
16507MmPar3 PDZ3, MmVE-CadherinXX
16510first PHD finger/non-modified histone H3 tail complexXX
16515mPar3 PDZ2XX
16516APE1 (39-318)XX
16518Tc GPXI monomerXX
16519SDF1a H25RXX
16520hPar3 PDZ2XX
16521CV 2116XX
16523pfColA monomerXX
16536Wilson Disease Associated ProteinXX
16538Pdcd4 MA-3MXX
16541Nurr1 monomerXX
16542Pdcd4 MA-3 M-CXX
16549Mus81 NTDXX
16555CA-CTD dimerXX
16558MAGI-1 PDZ1XX
16559MAGI-1 PDZ1 / E6CTXX
16560protein from gene locus NE0665XX
16570YbbR family protein Dhaf 0833XX
16576Protein BH0266 From Bacillus haloduransXX
16577Homeodomain DNA complexXXX
16579Flavodoxin oxidizedXX
16580Ribonuclease T1XX
165863F5 VHHXX
16587W60G beta2-microglobulinXX
16588Aha1 monomerXX
16590EF-hand domain of polycystin-2XX
16592BT9727 4915XX
16599clytin monomerXX
16601HCV Core-E1 signal peptideXX
16606kI O18/O8 Y87HXX
16607AL-09 H87YXX
16611SUMO-1 Daxx SIM complexXX
16612M2-TM amtXX
16618J-domain of CbpAXX
16622SH3 monomerXX
16624acyl carrier protein from a fungal type I polyketide synthaseXX
16627Protein GB1XX
16628MloK1 CNBD monomerXX
16638NHERF1 (150-358)XX
16639V of beta2-glycoprotein I and ligand-binding module complexXX
16641CD2AP SH3-A monomerXX
16642CD2AP SH3-B monomerXX
16643CD2AP SH3-C monomerXX
16646RBD1,2 domains from human nucleolinXX
16647CPF 0587XX
16656Q251Q8 DESHYXX
16660Substance P-NK1 complexXX
16668RhoA-GDP monomerXX
16669RhoA GTPgS monomerXX
16672transmembrane domain of the n-acetylcholine receptor beta2 subunitXX
16674cytochrome c3XX
16678Sensory Rhodopsin IIXX
16683REF2-I/HSV-1 ICP27 peptideXX
16690C. albicans Ess1 prolyl isomeraseXX
16704SPI2 (T7Y)XX
16705SPI2 (T7A)XX
16710spider rollXX
16711NP 415897.1XX
16715Vaccinia Related-Kinase 1XX
16721BRD1 PHD1 fingerXX
16726myristoylated NCS1XX
16731putative disulphide-isomeraseXX
16732PknB PASTA12XX
16733PknB PASTA23XX
16734PknB PASTA34XX
16735Anthrax Lethal Factor C-terminalXX
16736P62 PB1 DimerXX
16742Ribonuclease AXX
16743HuPrP(90-231 M129 Q212P)XX
16750c-src SH3XX
16751HSA salicylate complexXX
16752Troponins T and CXX
16753P450cam Pdx complexXX
16754RPA70A Rad51N complexXX
16755N40 C16 complexXX
16756Abl/Crk/Crk pY221 complexXX
16757PrP/copper complexXX
16758calbindin/CA complexXX
16759cytochrome c/phosphate complexXX
16760FPA/Gly-Pro-Arg-Pro complexXX
16761ATP7B N-domain/ATP complexXX
16762PP4R2/Calsensin complexXX
16763VHS/ubiquitin complexXX
16766BLM HRDC domainXX
16767Reg IVXX
16770PrgI mutantXX
16772CI-MPR domain5XX
16773CI-MPR domain5XX
16778CBX7/H3K27me2 complexXX
16781dynein microtubule binding domainXX
16782Photosystem II reaction center Psb28 proteinXX
16783Smr dimerXX
16784conotoxin mr3cXX
16785conotoxin cis-mr3cXX
16787Thermus thermophilus Rieske protein (cofactor bound)XX
16792SAP domain of MKL/myocardin-like protein 1XX
16797mTZD finger2XX
16803RanE66S dimerXX
16804Thermus thermophilus Rieske protein (cofactor bound)XX
16809Itk SH3 and Itk SH2 domainsXX
16812MED1:DNA complexXXX
16813complex of Ubl and SH3XX
16814mTZD finger1XX
16815mTZD finger3XX
16821SRU 0103XX
16824WASP/EspFU complexXX
16831C-domain of Lsr2XX
16838soluble tissue factorXX
16841Fibronectin 6FnI1-2FnII7FnIXX
16847LC8 bound to residues 233-249 of neuronal Nitric Oxide SynthaseXX
16854eye lens fragmentXX
16856acyl carrier proteinXX
16857Exon 6 of human Jagged-1XX
16860holo acyl carrier proteinXX
16870Human Tubulin Cofactor CXX
16871ZO-1 PDZ2XX
16880UBM2 in Complex with UbiquitinXX
16881polyketide cyclase SCO5315XX
16882Ubiquitin-Binding MotifXX
16884RRM3 monomerXX
16885UBM1-Ubiquitin complexXX
16886HCV NS2 [27-59]XX
16891alpha haemoglobin in monomer-dimer equilibriumXX
16893MDM4 N-terminal domainXX
16894MDM4-nutlin3 complexXX
16895UBB+1 (ubiquitin B mutant)XX
16898alpha-haemoglobin:AHSP protein complexXX
16899UBL domain of UBLCP1, I5MXX
16900MDM4-p53 complexXX
16901Human Relaxin-like FactorXX
16905Sma0114, response regulatorXX
16908Ubiquitin like domain of UBLCP1XX
16910Prestin STAS monomerXX
16915Human Insulin Mutant A22Gly-B31Lys-B32ArgXX
16916spMDD complex with ligandsXX
16921MinE dimerXX
16926E. coli lipoproteinXX
16928hERG N-terminal domainXX
16934PBS domainXX
16945chicken parvalbumin 3XX
16948GTPase Effector Domain ( GED)XX
16949PDZ3 of ZO-1XX
16954NHR3/PKA(RIIa) ComplexXX
16955calcium-bound CPV3XX
16961Dsy0195(21-82) proteinXX
16967MAST2-PDZ/PTEN-C TerminusXX
16968Derivative of HRFXX
16970Bem1p SH3-CI domain with Ste20pXX
16971TraI 381-569XX
16981SARS Coronavirus Nonstructural Protein Nsp7XX
16982D-allose binding proteinXX
16983PHD3 finger of MLLXX
16994C-Terminus Calmodulin F92EXX
16995bolA protein (ECH 0303)XX
16996human Rad51D NXX
17000E1-69 of Yeast V-ATPaseXX
17002YP 510488.1XX
17003N-terminal Vpr peptidesXX
17007Alpha-mannosidase binding domain of Atg34XX
17009mqsa ctermXX
17010Tryptophan apo-repressorXX
17011E2[296-331] segment of Hepaptitis C VirusXX
17012Tryptophan apo-repressorXX
17013Tryptophan apo-repressorXX
17014ChxR monomerXX
17018DAXX helical bundleXX
17019DAXX / Rassf1C complexXX
17020CV 0373(175-257) proteinXX
17023Znf A20XX
17024Znf A20:ubiquitin complexXX
17028Bacteriophage Lambda Tail Tube-gpV-CXX
17033Nonsense mRNA reducing factorXX
17036pja1 zinc finger domainXX
17040TM VIXX
17041holoTrpR dimerXX
17042nNOS fragmentXX
17043TMS2 domain of Dengue virus NS4A proteinXX
17044Rtt103 CTD complexXX
17045KSR1 CA1 monomerXX
17046holoTrpR dimer L75F variantXX
17047holoTrpR dimer A77V variantXX
17048AP180 M5XX
17052BLBC/CTO complexXX
17053Cc6/Cf complexXX
17054BSA/SXX complexXX
17055CR56/RAPd1 complexXX
17056Aa2/HLT complexXX
17057MbCN/PLM complexXX
17058AngII/CE complexXX
17059STAM1/ubiquitin complexXX
17061S100BE72A/CA complexXX
17069E73 HomodimerXX
17070talin domain CXX
17071Cbx3 H3K9me3 complexXX
17072Cbx7 H3K9me3 complexXX
17073CBP in complex with p53 TADXX
17078tRNALeu monomerXX
17080Shc-PTB complex with Integrin beta3XX
17081Prion with Y169G mutationXX
17082mouse prion protein with mutation F175AXX
17087Prion with Y169A, Y225A, Y226A mutationXX
17088P6.1 hairpinXX
17089SH3 monomerXX
17090YP 399305.1XX
17092DNA-binding protein SATB1XX
17093mMjCM-TSA complexXX
17094DNA 1/berenil complexXX
17095EIN HPr complexXX
17096DHFR unfoldingXX
17097NP2(L122V0)/IMD complexXX
17098RSP2/ATP complexXX
17099ribonuclease/EDTA complexXX
17100P85ALPHA/pY complexXX
17101AMP2/CTO complexXX
17102C2A/CA complexXX
17104YP 001336205XX
17105NP 954075.1XX
17107Human Insulin MutantXX
17108Human Insulin MutantXX
17109Family D SortaseXX
17112PKC-delta C1BXX
17113PKC-delta C1AXX
17114H2AZH2B/Chz1 complexXX
17115PGK amide exchangeXX
17116myoglobin/pyridine complexXX
17118PAZ/ZN/NiR complexXX
17119SLN/SERCA complexXX
17120cytc/1MZ complexXX
17121PISH3 refoldingXX
17123alphaL/CA complexXX
17124NP 888769.1XX
17126Heparanase 158-417XX
17131N-terminal domain of fibroin 1XX
17132amino-terminal UBA domain of OTUD7AXX
17135Drosophila Frataxin monomerXX
17138MBD2/p66-alpha complexXX
17145Pitx2 homeodomain R24HXX
17147Pitx2 homeodomainXX
17149Fyn SH3 A39V-N53P-V55LXX
17150phosphotransferase IIBXX
17170tvMyb2 MRE-1XX
17172RNase A C-dimerXX
17173Nrd1 CIDXX
17174Mouse prion proteinXX
17175SP 0782 homodimerXX
17176BT 0084 lipoproteinXX
17177visual arrestinXX
17178HSA/DTPA complexXX
17179rhGH hydrogen exchangeXX
17180HSA/TEP complexXX
17181ubiquitin ratesXX
17182FucP/arabinose complexXX
17183RasMg/GppNHp complexXX
17185cyclo/integrin complexXX
17186Abeta/CU complexXX
17187profilinI/pLp complexXX
17190Complex Rpp30XX
17195UBA monomerXX
17196Cu-binding proteinXX
17200UHRF1 Tandem Tudor Domains/Histone H3 complexXX
17203Acyl carrier proteinXX
17204ubiquitin-like small archaeal modifier proteinXX
17206VHD monomerXX
17213Mouse prion protein (121-231) with the mutation Y169AXX
17215OMcb5/Cc complexXX
17216PPBS/NCp7(12-55) exchangeXXX
17217SARS/dT10 complexXXX
17218CypA/peptide complexXX
17219YiiL-dimer/RNS complexXX
17221AZAMIF electron self exchangeXX
17222operator/repressor complexXXX
17223Ark1p/SH3 complexXX
17224CRT/ERp57 complexXX
17225CSD/ssDNA complexXXX
17226trHbN cyanometXX
17227GS-alfa-Ktx5.4 SCORPION TOXINXX
17231ArsD homodimerXX
17232PlyG (E.C.
17234Lrp DNA-binding domainXX
17240Influenza HA fusion peptide(G13A)XX
17245CCL21 SLC 6Ckine Exodus-2XX
17251SARS-CoV main protease N-terminal domainXX
17258Pineapple CystatinXX
17260UCHL1 S18Y variantXX
17263Small archaeal modifier protein 1 from Methanosarcina acetivoransXX
17265Fusion proteinXX
17267uncharacterized thiredoxin-like proteinXX
17268Thioredoxin CXX
17270Brd3 in complex with GATA-1 C-tailXX
17276unbound Alk5 ectodomainXX
17277putative thioredoxinXX
17278TgADF MonomerXX
17279rat epididymal lipocalin 12XX
17284E2 lipoyl domainXX
17285PHD finger (PHD1) from CHD4 (Mi2b)XX
17289Stromal Interaction Molecule 2XX
17302human liver fatty acid binding proteinXX
17303human liver fatty acid binding proteinXX
17305NLRP12 PYD monomerXX
17307HIV-1 Capsid in complex with stapled peptide InhibitorXX
17312Tah1 complex with C-terminus of Hsp90 (MEEVD)XX
17314Nonphosphorylated Peptide Recognizing DomainXX
17315C-terminal dsRBD of the Fission Yeast DICERXX
17316T box riboswitch Specifier domain and GA motifXX
17318YP 001092504.1XX
17319NP 253742.1XX
17320YP 926445.1XX
17321W protein of bacteriophage lambdaXX
17324Mus81-winged helix domainXX
17325Engrailed 2XX
17331GIP in Bicellular mediaXX
17333JD/UB complexXX
17334EGF/CA compplexXX
17338EGF34/CA complexXX
17339AREA/GATA complexXXX
17340cytc/MABE8 complexXX
17341CYP 2D6/MPTP complexXX
17344CHD4-PHD2/H3K9me3 complexXX
17360calcium-calmodulin complexesXX
17364PTB Domain of TENC1 in complex with the peptide of DLC1XX
17365ASHH2 a CW domainXX
17370protein BVU 1572(27-141)XX
17373pdz domainXX
17374ADF/Cofilin from Trypanosoma bruceiXX
17375hPCNA trimer complexed with C-terminal region of p21XX
17376hPCNA trimer complexed with C-terminal region of p21XX
17377Sans CEN2XX
17380RBP56 ZnFXX
17381putative surface proteinXX
17382Raf-1 kinase inhibitor proteinXX
17383Crimean Congo Hemorrhagic Fever Virus Cytoplasmic Gn TailXX
17385TEX13A ZnFXX
17386RBM10 ZnFXX
17387RBM5 ZnFXX
17396Zn bound FCS domain of hPh1XX
17398A protein from fission yeastXX
17412GABARAPL-1 and NBR1-LIR complexXX
17415cytochrome P450camXX
17422Cidofovir DNA duplexXX
17423Control DNA duplexXX
17424Integrin 1XX
17427p21 kinase inhibitory domain bound to Cdk2 and Cyclin AXX
17431outer membrane protein RcsFXX
17434C-terminal domain of Bv3FXX
17435C-terminal domain of Salmonella H-NSXX
17440trans-Resveratrol in complex with the cardiac regulatory protein Troponin CXX
17443Solution structure of human ubiquitin conjugating enzyme Rad6bXX
17444LR11 SorLAXX
17448protein YP 546394.1XX
17456THAP domain of human THAP11XX
17457b5 exchangeXX
17459dynaminPHdomain/IBS complexXX
17464FGF/NTS complexXX
17465aII exchangeXX
17467VRN1 B3bXX
17468NS5A fragment (191-369) monomerXX
17469ClpP F-SXX
17471p38 alphaXX
17473Chimera monomerXX
17475Structural basis of p63a SAM domain mutants involved in AEC syndromeXX
17477Mouse MFG-E8 C2 DomainXX
17485mSin3A PAH2-Pf1 SID1 ComplexXX
17487monomer of ICL3 (residues A221 to K345) 5-HT1AXX
17490C-terminal domain of Prp24XX
17492Thuricin CDXX
17495Thuricin CDXX
17501NP 344798.1XX
17507DJ-1 proteinXX
17509YP 557733.1XX
17510protein ligand complexXX
17511LZ-GCN4 dimerXX
17512primase CTDXX
17513Immunity protein 7XX
17515INAD PDZ5 complexed with Kon-tiki peptideXX
17523Norwalk virus proteaseXX
17529Nedd4LW3/smad3 complexXX
17530AHSA1-like protein RHE CH02687 (1-152)XX
17534SpaI monomerXX
17536Complex of SUMO1 with RanBP2 M-IR2 SIM peptideXX
17537Human minimembrane protein OST4XX
17538second WW domain from human YAP in complex with a human Smad1 derived peptideXX
17539first WW domain of human YAP in complex with a human Smad1 doubly-phosphorilated derived peptideXX
17540human Yap in complex with a human Smad1 derived peptideXX
17541human Smurf1 in complex with a phosphorylated human Smad1 derived peptideXX
17542human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptideXX
17543first domain of human Smurf1 in complex with a human Smad1 derived peptideXX
17544second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 (res 178-189) derived peptideXX
17545first domain of human PIN1 in complex with a human Smad3 derived peptide( resi 173-186)XX
17552Ph SAM linkerXX
17553acyl CoA binding proteinXX
17554tandem UBA of USP13XX
17556yPEPmin of Rsa1pXX
17558CHR/DPC micelleXX
17559FZL2 (monomer)XX
17560FZL4 (monomer)XX
17567TASL2 (monomer)XX
17568TASL3 (monomer)XX
17570Ure2p prionXX
17574yeast RNase III dsRBD complex with a non-canonical RNA substrateXXX
17575C domain of Rv0899XX
17578H/ACA RNP protein Nhp2p-S82W mutantXX
17579H/ACA RNP protein Nhp2pXX
17580Myc G-quadruplexXX
17583thurincin HXX
17585Rv0020c NterXX
17586Rv0020c FHAXX
17590Anabaena sensory rhodopsin transducerXX
17591Anabaena Sensory Rhodopsin Transducer with F-tailsXX
17592Anabaena Sensory Rhodopsin Transducer with DNAXXX
17602Phosphomannomutase/Phosphoglucomutase MonomerXX
17606RBBP1 chromobarrel domainXX
17607RBBP1 tudor domainXX
17611Rmet 5065XX
17616plasmodium falciparum ribosomal lateral stalkXX
17620D2 domain of human fibroblast growth factor receptor 4XX
17626Act2-EF34-palladin complexXX
17629Nbp2 SH3 and Ste20 peptideXX
17630JAZ ZF1XX
17631JAZ ZF2XX
17634Cytidine Repressor DNA-Binding DomainXX
17635FUS/TLS RRM domainXX
17636Grx domainXX
17637short Grx domainXX
17638Ebolavirus Fusion Loop pH 5.5XX
17640EL222 monomerXX
17643YtvA DimerXX
17645myosin VI lever arm extensionXX
17648A30P alpha-synuclein fibrilsXX
17652S108C mutant of Phosphomannomutase/PhosphoglucomutaseXX
17653SAP30 and PAH3XX
17655Human Telomeric DNAXX
17656P1 endolysin LyzXX
17660LmrA-NBD ADP complexXX
17663ORF57 56-140XX
17664ORF57 103-120XX
17669Trp-Cage mini-protein with D-amino acidXX
17671RNA (27-MER)XX
17672JAZ ZF4XX
17675NTL9 V3AI4A double mutantXX
17679JAZ ZF3XX
17682RNA (31-MER)XX
17687PARP-1 BRCT domainXX
17689Uracil-DNA glycosylase inhibitor p56XX
17692Dynein Light Chain 8XX
17693RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptideXX
17694GH84A CBM32-1XX
17695Extracellular domain of GLICXX
17700TRX IntactXX
17701ykud no mutationsXX
17702protein complex for DNA replicationXX
17707SRSF2 RRM/RNA complexXXX
17711SMN-Gemin2 complexXX
17714human prion protein mutant HuPrP(90-231, M129, V210I)XX
17717NMR Structure of Mouse ApoAI(1-216)XX
17719esophageal cancer-related gene 2XX
17724KSR1 CA1-CA1a domainXX
17725KSR1 CA1-CA1a domainXX
17727KcsA-Kv1.3 (Closed state)XX
17729C-Terminal domain of LerXXX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNAXXX
17736AHSA1-like protein CHU 1110XX
17737HopPmal 281 385XX
17738HIV-1 CAXX
17739HopAB1Pph1448 220 320XX
17741ETV6 Q436XX
17742ETV6 R458XX
17744KcsA-Kv1.3 (Inactivated state)XX
17745PFV RNase HXX
17750N-terminal domain of E3 ligase HECW2XX
17753HR3111A dimerXX
17755Reg I-alpha monomerXX
17771CaM-OLFp complexXX
17777Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiGXX
17780Human prion protein with E219K protective polymorphismXX
17784PhyRSL-NepR complexXX
17799YP 001302112.1XX
17805single polypeptide chainXX
17806YP 001302112.1XX
17807Ca2+/CaM L-selectin peptide complexXX
17808Structure of PHD domain of UHRF1 in complex with H3 peptideXX
17809AHSA1-like protein AHA 2358XX
17812R2 of histone H3 tail by UHRF1 PHD fingerXX
17813NMR structure of the UHRF1 PHD domainXX
17815IMP1 KH34XX
17818FKBP-type peptidyl-prolyl cis-trans isomeraseXX
17820IsdH-N2N3 monomerXX
17821Human C30S/C59S-Cox17 mutantXX
17828HOIL-1 UnlXX
17829C2 DomainXX
17833Skint1 IgVXX
17849yCaM 123XX
17850yCaM GS CNA1XX
17860RNA (37-MER)XX
17861RNA (37-MER)XX
17862Staphylococcus aureus IsdH linker domainXX
17864CTD monomerXX
17867Myosin Binding Protein-C MotifXX
17868MUC2 Mucin Domain PeptideXX
17869MUC2 Mucin Domain Peptide, SUGAR (3-MER)XX
17870MUC2 Mucin Domain Peptide, SUGAR (2-MER)XX
17871Mucin Glycoprotein RecognitionXX
17872MUC2 Mucin Domain PeptideXX
17873Mucin sequence based on MUC2 Mucin glycoprotein tandem repeatXX
17874MUC2 Mucin Domain PeptideXX
17875MUC2 Mucin Domain PeptideXX
17876Novel Toxin from De Venom of the Scorpion TityusXX
17880yeast proteinXX
17881C-CaM apo formXX
17883Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNAXXX
17888Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392XX
17890CCL2 (free)XX
17892CylR2 homodimerXX
17893CylR2 homodimerXX
17902CCL2 (+carbohydrate)XXX
17905GED rrACBcsXX
17908Acidic Scorpion Potassium Channel ToxinsXX
17912third SH3 domain of R85FLXX
17917Tfg1 C-terminal domainXX
17921GAAA tetraloop monomerXX
17927putative thiol-disulfide oxidoreductaseXX
17930monophosphorylated (747pY) beta3 integrinXX
17931biphosphorylated (747pY, 759pY) beta3 integrinXX
17932monophosphorylated (747pY) beta3 integrinXX
17934AIDA1 PTB domainXX
17935GATase subunit (monomer) of GMP SynthetaseXX
17942Complex of hDlg and E6XX
17944C-terminal Trx reassemblyXX
17946Dihydrofolate reductase from Moritella profundaXX
17952C5 protein monomerXX
17953NMR Structure of protoporphyrin-IX bound murine p22HBPXX
17955(C9S, C14S)-leucocin AXX
17962putative oxidoreductase from Ehrlichia chaffeensisXX
17964HIV-1 PR HomodimerXX
17967N-terminal domain of HPV16 E6 oncoproteinXX
17968HPV16 E6XX
17973onconase FLG variantXX
17979Zn(II) form of DesulforedoxinXX
17981C-CaM/PEP-19 complexXX
17982C-CaM/Ca complexXX
17983C-CaM/PEP-19 complexXX
17986cyclic gomesinXX
17989UUP protein C-terminal domainXX
17991Nicotinic Acetylcholine ReceptorXX
17992Nicotinic Acetylcholine ReceptorXX
17994HIV-1 PR HomodimerXX
17996HIV-1 PR HomodimerXX
17997Cd(II) form of DesulforedoxinXX
18004Structural and functional analysis of the DEAF-1 and BS69 MYND domainsXX
18005Molecular systemXX
18006Molecular systemXX
18007Molecular systemXX
18008Molecular systemXX
18012N-terminal domain of human TIG3XX
18018YP 916642.1XX
18022Cx43 C-terminal domain bound to tubulinXX
18023Cyclo-TC1 Trp-cageXX
18026guanylyl cyclase activating protein-1, GCAP1XX
18037ykud imipXX
18047NP 814968.1XX
18048NPM1 C70XX
18049RNA-binding subunit of the TRAMP complexXX
18051myb-like1 domain of hDMP1XX
18080amyloid precursor protein's transmembrane domainXX
18082Calmodulin N-lobe bound with ER alpha peptideXX
18084Calmodulin C-lobe bound with ER alpha peptideXX
18088Post-translational S-nitrosylationXX
18089Post-translational S-nitrosylationXX
18093transmembrane domains of the a4b2 nAChRXX
18097rhesus SPRY domainXX
18102Cysteine Deleted Analog of Tachyplesin-1XX
18110C-terminal RAGE (ctRAGE)XX
18113allergenic beta parvalbuminXX
18114human LL-23XX
18115C-terminal Domain (537-610) of Human Heat Shock Protein 70XX
18116ubiquitin monomerXX
18121CdnL N-terminal domainXX
18122Photoactive Yellow ProteinXX
18138MDR 769 homodimerXX
18154YqcA from Escherichia coliXX
18158N-terminal domain (6-74) of human ZBP1 proteinXX
18169Ca-bound S100A4 in complex with non-muscle myosin IIAXX
18171atTic-hip/hop domain (Residue 310-371)XX
18176cytosolic region of human VIMPXX
18177cytosolic region of human VIMPXX
18178AGR2 residues 41-175XX
18179E60A mutant AGR2XX
18182Vav2 and Arap3XX
18195optn 550XX
18196proteinase inhibitorXX
18197angiogenin monomerXX
18198NIPP1 monomerXX
18200RstA CXX
18201HasR N-terminal periplasmic signaling domainXX
18203Mu-contoxin BuIIIBXX
18205PDZ Domain of CAL and C-terminus of the CFTRXX
18206Conotoxin analogue [D-Ala2]BuIIIBXX
18209DNA molecule G3ATG3ACACAG4ACG3XX
18211Lotus domains 2 and 3XX
18216acyl-carrier protein from Rickettsia prowazekiiXX
18228TpbA monomerXX
18229complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2XX
18230S100A1 dimerXX
18231S100A1 homodimerXX
18234P1-CheY/P2 complexXX
18244complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15XX
18253P1 endolysin LyzXX
18255MbtH-like proteinXX
18256monomeric phospholamban (C36A, C41F, C46A)XX
18265WIP C-terminal domainXX
18266Dengue Virus NS2B/NS3 in complex with AprotininXX
18267DNA Polymerase beta uncomplexedXX
18268EF-hand domain of polycystin-2XX
18269N-terminal domain of human CDNFXX
18276PrgI needleXX
18278FKBP12 from Aedes aegyptiXX
18284antifreeze peptide 1mXX
18286antifreeze peptide 3XX
18288Ninjurin1 monomerXX
18289antifreeze peptide 4mXX
18296BRD1 PHD2 fingerXX
18299K60A mutant of Atox1XX
18300Solution NMR structure of asteropusin A from marine sponge Asteropus sp.XX
18302calcium-bound CaM N-terminal domain in a complexXX
18306A2POBEC2 41-224XX
18307A2POBEC2 1-224XX
18309FliGn homodimerXX
18312PiCyp AXX
18313A domain of talinXX
18317sugarcane cystatinXX
18319Y4 TM1-TM2XX
18322reduced Mrx1XX
18323calcium-bound CaM C-terminal domain in a complexXX
18325oxidized Mrx1XX
18326Ni(II)-bound NmtR homedimerXX
18327atypical SH3 domain of DOCK180XX
18332Escherichia coli PorinsXX
18336RNA (27-MER)XX
18341Sgt2 NT homodimerXX
18342Get5 UBL domainXX
18345anti-fungal defensin DEF4 (MTR 8g070770)XX
18346NP 390037.1 from Bacillus subtilisXX
18348EB1 CH domainXX
18353Kelch domain of mouse Keap1XX
18356ADF like UNC-60A ProteinXX
18363Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptideXX
18364GS13500A assemblyXX
18371EB1 C-terminal domainXX
18375staphyloxanthin proteinXX
18386HP1 CSDalpha(109-185)XX
18387thiol:disulfide interchange proteinXX
18392EIC dimerXX
18394uncharacterized thioredoxin-like protein BVU 1432XX
18396nanocrystalline DsbAXX
18398WNK1 Autoinhibitory DomainXX
18399ubiqutin-like protein from Trypanosoma buceiXX
18403UIM-SH3 monomerXX
18404Target Recognition Domain of Zoocin AXX
18411putative protein disulfide isomeraseXX
18412phosphoprotein enriched in astrocytes 15AXX
18415human C-type lectin domain family 4 member DXX
18416ubiquitin homology of mouse BAG-1XX
18419B2 domain of Neisseria meningitidis Pilus assembly protein PilQXX
18421eiavCA monomerXX
18425S100A11 dimerXX
18426human prion proteinXX
184272'F-ANA and ANA self-complementary duplexXX
18431mouse Rev1 C-terminal domainXX
18433mouse Rev1 CTD in complex with the RIR of Pol KappaXX
18434C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)XX
18435C-terminal domain of Tetrahymena telomerase protein p65XX
18437gpFI C-terminal domainXX
18440Analog of the fragment 197-221 of 1- adrenoreceptorXX
18442R. rickettsii cold shock-like proteinXX
18446Apoform of HahellinXX
18448NIPP1 1-143XX
18452Synthetic cyclic oligonucleotideXXX
18458HIRAN domainXX
18459N0 domain of Neisseria meningitidis Pilus assembly protein PilQXX
18466Wild-type FAS1-4XX
18467FAS1-4 R555WXX
18470Cu(I) gt CsoRXX
18471PWWP domainXX
18472Apo form gt CsoRXX
18473L-PGDS/U-46619 complexXX
18474pwwp domain of TFIIS2-1XX
18475P2 gpXXX
18477A.fAglB S2XX
18478P75/LEDGF PWWP DomainXX
18485Tb 1-C-Grx1 monomerXX
18492SANT2 domain of NCoR2XX
18494TM0026 monomerXX
18496YdbC:dT19G1 complexXXX
18497autoinhibitory domain of human AMP-activated protein kinase catalytic subunitXX
18498YAP WW2 in complex with a Smad7 derived peptideXX
18499YAP WW1 in complex with a Smad7 derived peptideXX
18500Smurf1 WW2 domain in complex with a Smad7 derived peptideXX
18501NEDD4L WW2 domain in complex with a Smad7 derived peptideXX
18502Smurf2 WW3 domain in complex with a Smad7 derived peptideXX
18503RNA (49-MER)XX
18507beta2 carbohydrate module of AMP-activated protein kinaseXX
18508beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrinXX
18513recombinant tamapinXX
18515RNA (37-MER)XX
18518LC3B OPTN-LIR Ptot complex structureXX
18520S72-S107 peptide of 18.5kDa murine MBPXX
18521Vta1-Vps60 complexXX
18522PICK1 PDZ domain fused to the C10 DAT ligandXX
18534Ribonuclease III in complex with RNA (32-MER)XXX
18535Ribonuclease IIIXX
18538GPVI peptide mimeticXX
18542Cytosolic Tails of aXb2 IntegrinXX
18543DsbA(C33S) proteinXX
18545C85M S100A1 dimerXX
18551C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497)XX
18557Ca2+-bound CaBP7 N-terminal domanXX
18560hs356 22 132XX
18567S114A mutant of UVI31+XX
18570zinc finger AFV1p06 proteinXX
18571apo-Phl p 7XX
18572hemi-Mg-bound Phl p 7XX
18573Ca-bound Phl p 7XX
18574wild-type Lipase AXX
18575variant XI LipAXX
18579Methylated Histone ComplexXX
18587MHV nsp3a momonerXX
18588Tyr tRNA SynthaseXX
18592MRH domainXX
18598LytTR domainXX
18602soluble domain of MmpS4XX
18604Solution structure of CCP modules 10-11 of complement factor HXX
18606anti-CRISPR protein Acr30-35XX
18617G8A mutant of the influenza hemagglutinin fusion peptideXX
18620RRM domainXX
18621La-type RNA-binding domainXX
18622second CARD of human RIG-IXX
18623mutant (T170E) second CARD of human RIG-IXX
18624N-terminal domain of a plant GrxXX
18627VILIP-3 monomerXX
18630N-80 ALRXX
18631N-80 ALR reducedXX
18634human beta-defensins 1 and 6XX
1863811 mer oligonucleotide-BXX
18639Duplex DNA Containing a b-Carba-Fapy-dG LesionXX
18640Duplex DNA Containing a b-Carba-Fapy-dG LesionXX
18641PawS derived peptide 11 (PDP-11)XX
18643PawS Derived Peptide 4 (PDP-4)XX
18644PawS Derived Peptide 5 (PDP-5)XX
18645PawS Derived Peptide 7 (PDP-7)XX
18648APPTM V44M dimerXX
18649APPTM dimerXX
18650RelA-TAD/CBP-TAZ1 complexXX
18651MxiH needleXX
18652alpha sub-domainXX
18654Single-chain InsulinXX
18655Transmembrane Arced Helix (ArcH)XX
18658peptide a2N(1-17) from Mus musculus V-ATPaseXX
18659peptide epsilon(103-120)XX
18667Solution structure of eIF4E3 in complex with m7GDPXX
18673potential acylphosphatase from Giardia lambliaXX
18677RING domain in ubiquitin ligase gp78XX
18679LmCsp dT7XX
18685adenylate kinaseXX
18688gp78 RING bound to Ube2g2:G2BRXX
18691tpr1 domainXX
18693Exocrine gland-secreting peptide 4XX
18694KIX domain complexXX
18695KIX domain complex (3)XX
18697rmodN-ACSL complexXX
18701UNC-60B from Caenorhabditis elegansXX
18704Siglec5 CRDXX
18705Antimicrobial Peptide Human Defensin 5XX
18707TamA POTRA domain IXX
18716HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serineXX
18718alpha 4 integrin tailXX
18719beta 2 integrin tailXX
18720Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptideXX
18724G-quadruplex DNAXX
18730West nile proteaseXX
18732NP 390345.1XX
18734ZP 02034617.1XX
18736Conotoxin TxIBXX
18749Ligase 10CXX
18753biofilm matrix promoter AbbA from B. subtilisXX
18756WT IkappaBalphaXX
18758First Catalytic Cysteine Half-domainXX
18759CPAP IkappaBalphaXX
18760YLTA IkappaBalphaXX
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyreneXX
18765RRM1 monomerXX
18766PI-AnmTX Ugr 9a-1XX
18768NS2(2-32) GBVB proteinXX
18769NS2(32-57) GBVB proteinXX
18770TatA T22PXX
18771TatA oligomerXX
18774omp synthaseXX
18775omp synthaseXX
18779FrpD proteinXX
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-linkXX
18785Erbin PDZ WTXX
18786Erbin PDZ S47XX
18788staphylococcal nuclease E43S mutantXX
18789Kunitz-type neurotoxin LmKKT-1aXX
18795Amylin monomerXX
18796OmpX in phopspholipid nanodiscsXX
18797OmpX in DPC micellesXX
18803MHV N-linker peptideXX
18804ErbB1 (EGFR, HER1)XX
18807ceN SAS-6XX
18808Nterminal domain of splicing factor 1XX
18813human PHF1 in complex with H3K36me3XX
18814H-NS oligomersXX
18818human S100A14XX
18824extended PDZ1 domain from NHERF1XX
18825C-terminal CFTR peptide and extended PDZ1 domain from NHERF1XX
18826C-terminal CFTR peptide and extended PDZ2 domain from NHERF1XX
18828holocytochrome cXX
18829TIA-1 proteinXX
18830ALPS-23 peptide in SDS micellesXX
18832SH3 domain of DOCK180XX
18837VHH 18XX
18838ID3 stem loop of domain 1 in the ai5gamma group II intronXX
18839monomeric sugarcane canecystatinXX
18840CPEB1-ZZ G-P-504-566XX
18841Antitoxin PaaA2XX
18842complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4XX
18847stacked G-quadruplex formed by human TERRA sequenceXX
18851HIV-1 Rev ARM single polypeptide chainXX
18852HIV-1 Rev ARM peptide (residues T34-R50)XX
18853LpoA n-terXX
18856GtYybT PAS HomodimerXX
18858Biosynthetic engineered B28K-B29P human insulin monomerXX
18859Biosynthetic engineered B28K-B29P human insulin monomerXX
18860a-synuclein fibrilsXX
18861Antiamoebin IXX
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutionsXX
18870dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)XX
18871chaperone in type III secretion systemXX
18872ID3 stemXX
18873Lewisx-sp8 acetateXX
18874ING4 PHD mutant N214DXX
18875[Aba5,14]BTD-2, cyclic peptideXX
18877CaBP4 polypeptideXX
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybridXXX
18882TICAM-2 TIR domainXX
18883TICAM-1 TIR domainXX
18887hypothetical protein lmo0427XX
18888EGFR transmembrane - juxtamembrane (TM-JM) segmentXX
18891Tetrahymena telomerase RNA stem IV terminal loopXX
18892helix II template boundary element from Tetrahymena telomerase RNAXX
18893d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1XX
18894d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gammaXX
18895N-terminal MAP1B LCXX
18897NMR structure of the glycosylated conotoxin CcTx from Conus consorsXXX
18899Doc monomerXX
18901C-terminal domain of the protein HCFC1XX
18904two domain PPIase SlpA from Escherichia coliXX
18905RRM2 domain of the protein RBM10 from homo sapiensXX
18907Duplex DNAXX
18908Human programmed cell death 1 receptorXX
18919Full-length cytochrome b5 with heme BXX
18921[L-HisB24] insulin analogue at pH 1.9XX
18923[L-HisB24] insulin analogue at pH 8.0XX
18924chain AXX
18925chain AXX
18927V5 domain of Protein Kinase C alphaXX
18928T638E/S657E V5 domain of Protein Kinase C alphaXX
18929V5 domain of Protein Kinase C alphaXX
18930T638E/S657E V5 domain of Protein Kinase C alpha, DPVXX
18933ASFV Pol XXX
18934Binary complex of African Swine Fever Virus Pol X with MgdGTPXX
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNAXXX
18939C-terminal AbrBXX
18941LFA-1 I-DomainXX
18942alpha-1 integrin I-domain in complex with GLOGEN triple helical peptideXX
18951MYB-like DNA binding domain of KNL-2 from C. ElegansXX
18958Integrin L Transmembrane DomainXX
18963Dido PHDXX
18964Novel Alpha4/6-Conotoxin TxICXX
18965Marine Sponge-Derived Asteropsin EXX
18969S55A mutant of UVI31+XX
18976Ca-containing EF-hand proteinXX
18977Phosphate-bound TpbAXX
18980NC inhibitor 3 complexXX
18986C-terminus of the minichromosome maintenance protein MCMXX
18988apo paHOXX
18993Alt a 1XX
18998Allatide O4 conformation 2XX
18999allatide conf1XX
19000VV2 0175XX
19007MinC N-terminal monomerXX
19008SinR FLXX
19010Titin C1XX
19013RRM domain of the hypothetical proteinXX
19014putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegansXX
19017Bulges in G-quadruplexesXX
19023RNA polymerase binding protein A (RbpA)XX
19024single G-bulge in a conserved regulatory region of the HEV genomeXX
19025CAP-Gly monomerXX
19027rubredoxin type protein from Mycobacterium ulceransXX
19031CAP-Gly/EB1 heterotetramerXX
19035G-rich VEGF aptamer with LNA modificationsXX
19037h-prune C-terminal domainXX
19039domain 5 from Azotobacter vinelandii Intron 5XX
190402'-5' AG1 lariat forming ribozymeXX
19042Frataxin like monomerXX
19043Protein A binding by an engineered Affibody moleculeXX
19046Phosphatase domain of PTPN5XX
19051calcium channel beta subunitXX
19052Ebolavirus Fusion Loop L529A/I544AXX
19056IsdB N1XX
19058doublet cross-beta amyloid fibrilXX
19060triplet cross-beta amyloid fibrilXX
19062cross-beta protofilamentXX
19067Solution structure of latherinXX
19072HIV-1 PR HomodimerXX
19078fibrillin e2cb1XX
19081P4 CPEB3XX
19082thymidylate synthaseXX
19085SPI-2 inhibitorXX
19086Solution structure of human ribosomal protein P1.P2 heterodimerXX
19087C-terminal RV0431XX
19089adenylate kinase with ADPXX
19090adenylate kinase with ADPXX
19091adenylate kinase with ADPXX
19092adenylate kinase with ADPXX
19093adenylate kinase with ADPXX
19094Enterocin 7AXX
19099human beta-2 microglobulinXX
19101Enterocin 7BXX
19108human restriction factor APOBEC3AXX
19113B2709-b2m-pVIPR complexXX
19116B2709-b2m-TIS complexXX
19117Domain 11:IGF2 complexXX
19118B2709-b2m-pLMP2 complexXX
19119B2709-b2m-pGR complexXX
19120B2705-b2m-pVIPR complexXX
19121B2705-b2m-TIS complexXX
19122B2705-b2m-pLMP2 complexXX
19123B2705-b2m-pGR complexXX
19124antimicrobial peptide Tk-Amp-X2XX
19127lambda lysozymeXX
19138ED ComplexXXX
19142vertebrate toxin from the badge huntsman spiderXX
19144CAP mutant (T127L and S128I) in the apo stateXX
19145A structural model of CAP mutant (T127L and S128I) in cGMP-bound stateXX
19146RING domain of E3 ubiquitin ligase Doa10XX
19147APC/C CDH1-EMI1: multimodal mechanism of E3 ligase shutdownXX
19155CbpAN from Streptococcus pneumoniaeXX
19156Hedgehog Autoprocessing DomainXX
19163J-domain of human DnaJA1XX
19165HdeA homodimerXX
19168C-terminal domain of translation initiation factor IF-3XX
19169PG 2175XX
19170calmodulin-binding domain of plant calcium-ATPase ACA8XX
19171TRD of MBD1XX
19172PTPN11 C-SH2 freeXX
19173PTPN11 C-SH2 boundXX
19180Trp-cage Circular PermutantXX
19183Trp-cage 16b P12W: a Hyperstable MiniproteinXX
19184calmodulin-binding domain of plant calcium-ATPase ACA2XX
19186S72-S107 peptide of 18.5 kDa MBPXX
19187Methanothermobacter thermautotrophicus MCM C-terminusXX
19197C-terminal structure of (Y81F)-EhCaBP1XX
19201TAX1BP1 UBZ1+2XX
19203RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1XX
19204BAF155 SWIRM domainXX
19205Engineered Cystine Knot Protein 2.5DXX
19206PcCBM36 monomerXX
19208Arginine kinase transition state analogue complexXX
19214Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome DomainXX
19219Yeast Rpn9XX
19220proteasome related subunit N terminal domainXX
19221proteasome related subunit C terminal domainXX
19225GM CBM21XX
192262'F-RNA/2'F-ANA chimeric duplexXX
19235Aha1 dimer from Colwellia psychrerythraeaXX
19238Calmodulin prototypical calcium sensorXX
192392c TCRXX
19243Domain 1 from E. coli HisJXX
19244Domain 2 from E. coli HisJXX
19245HisJ and HistidineXX
19249PAI subdomain of Sleeping Beauty transposaseXX
19253tau K18XX
19258Pin1 WW domainXX
19260RNA (48-MER)XX
19271CRABP1 apoXX
19275Bovicin HJ50XX
19277d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybridXX
19279d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybridXX
19282lymphocyte receptor NKR-P1AXX
19285Calcium SensorXX
19286BeF3 Activated Sma0114XX
19291Pin1 WW domain mutant 5-1XX
19292Pin1 WW domain mutant 5-1gXX
19293calcium-bound human S100A12XX
19294DNA-binding domain of T. brucei telomeric protein tbTRFXX
19295Pin1 WW domain variant 6-1XX
19296Pin1 WW domain mutant 6-1gXX
19302ERCC4 domain of human FAAP24XX
19303(HhH)2 domain of human FAAP24XX
19304kalata B7XX
19305an inhibitor bound dengue NS3 proteaseXX
19306an inhibitor bound dengue NS3 proteaseXX
19311Saccharomyces cerevisiae Est3 proteinXX
19315HHARI Catalytic DomainXX
19317DNA helicase RecQXX
19319RasGRP2 EF hands bound to calciumXX
19321cerato populinXX
1932526S proteasome subunit monomerXX
19330DUSP16 MonomerXX
19334Temporin-1 Ta in lipopolysaccharide micellesXX
19338aSyn A53T monomerXX
19344aSyn S87NXX
19345aSyn A53T&S87NXX
19346aSyn mouseXX
19347aSyn mouse T53AXX
19348aSyn mouse N87S monomerXX
19349aSyn mouse T53A&N87S monomerXX
19350acetylated aSyn monomerXX
19351acetylated aSyn A53T monomerXX
19353AS69 ASynXX
19357Met66 BDNF ProdomainXX
19358Val66 BDNF ProdomainXX
19362STIM1 CC1-CC2 homodimerXX
19363STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domainsXX
19366region 2 of E. coli sigmaEXX
19368Structure of Pex14 in complex with Pex5 LVxEF motifXX
19369calbindin D9k Apo-formXX
19370calbindin D9k calcium bound-formXX
19371calbindin D9k magnesium bound-formXX
19372Ani s 5 Anisakis simplex allergenXX
19374alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosaXX
19376Calmodulin, C-terminal domainXX
19377IL10 dimerXX
19379alpha7 nAChR transmembrane domainXX
19380RNAP alpha subunit CTDXX
19383Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2XX
19384conotoxin muPIIIA-1XX
19385conotoxin muPIIIA-2XX
19386parallel-stranded G-quadruplex in DNA poly-G stretchesXX
19389stacked dimeric G-quadruplexXX
19392CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous AssemblyXX
19393Abeta FibrilsXX
19394human Polymerase iota UBM1-Ubiquitin ComplexXX
19398Forkhead DNA binding domain of Brugia malayi DAF-16aXX
19399EKLF(22-40)/Ubiquitin ComplexXX
19402antiparallel (2+2) G-quadruplexXX
19404OR33 cnsXX
19407trimeric SkpXX
19408trimeric Skp with bound OmpXXX
19409Trimeric Skp with bound tOmpAXX
19410tOmpA within the tirmeric chaperone SkpXX
19411OmpX within the trimeric chaperone SkpXX
19415LMO4-LIM2 in complex with DEAF-1 (404-418)XX
19416Rrp7 C-terminal DomainXX
19418PICK1 PDZ GluA2XX
19424RyR2A delta exon 3XX
19425mouse RyR2 domain AXX
19426kv14 pep61XX
19427BldD-CTD monomerXX
19430Salmonella MgtRXX
19432Cat r 1XX
19433YP 002937094.1XX
19435Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligandXX
19436murine norovirus NS1/2 D94E mutantXX
19439murine norovirus NS1/2 CW3 WTXX
19442E7 dimerXX
19444murine norovirus CR6 NS1/2 proteinXX
19448dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequenceXX
19449BolA-like hypothetical protein RP812XX
19452putative thioredoxin (ECH 0218) in the reduced state from Ehrlichia chaffeensisXX
19458Recombinant CR1 fragment, domains 2-3XX
19459Recombinant CR1 fragment, domains 1-2XX
19466PICK1 PDZ ASIC1a C-termXX
19468WR17 LPSXX
19469WK10 LPSXX
19470KR8 LPSXX
19471WG12 LPSXX
19472Sp140 PHD finger trans conformerXX
19473Sp140 PHD finger cis conformerXX
19474uninhibited ETV6 ETS domainXX
19477P130Cas SDXX
19479Active Site Mutant Pepitdyl Carrier ProteinXX
19482Regulatory Domain of Tyrosine HydroxylaseXX
19483WW domain of HYPBXX
19485SVIP mutationXX
19487PP2WW mutant (KPP2WW) of HYPBXX
19488WW domain with polyproline stretch (PP2WW) of HYPBXX
19490cdN dimerXX
19498bacteriophage T7 encoded inhibitor (gp1.2)XX
19503WW Domain with Loop 1 ExcisedXX
19505WW Domain Strand-Swapped DimerXX
19508human wild type FAPP1-PH domainXX
19511homeodomain transcription factor Gbx1XXX
19516Dot1L-AF9 complexXX
19531trimeric mutant TM domain of VEGFR2 receptorXX
19532mutant dimeric TM domain of VEGFR2 receptorXX
19533NusE (S10) from Thermotoga maritimaXX
19534non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complexXXX
19540MyT1 F4F5 - DNA complexXXX
19541Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39XX
19544RsmZ(SL1)/RsmE(dimer) 2:1 complexXXX
19545cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03XX
19546RsmZ(SL2)/RsmE(dimer) 2:1 complexXXX
19547RsmZ(SL3)/RsmE(dimer) 2:1 complexXXX
19548RsmZ(SL4)/RsmE(dimer) 2:1 complexXXX
19549RsmZ(36-44)/RsmE(dimer) 2:1 complexXXX
19551hFKBP25 monomerXX
19552Blo t 19, a minor dust mite allergen from Blomia tropicalisXX
19553Blo 1 12 CBD domainXX
19554Domain 2 of E. coli ribosomal protein S1XX
19555C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11XX
19556C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1XX
19557circular g-domain analog from the wheat metallothionein Ec-1XX
19560Middle domain of Hsp90alphaXX
19580PAP262-270 in SDS micellesXX
19581peptide derived from the trans-membrane region of HIV-1 gp41XX
19582peptide derived from the membrane proximal external region of HIV-1 gp41XX
19583peptide derived from the membrane proximal external region of HIV-1 gp41XX
19584Dvl-2 DEPXX
19585computational designed dimer based on the engrailed homeodomain structureXX
19586Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495XX
19590Fyn SH3 G48AXX
19591FF domain L24A mutantXX
19594G-quadruplex bound to the bisquinolinium compound Phen-DC3XX
19598WHEP repeatsXX
19599hman EPRS R12 repeatsXX
19604complex of calmodulin with minimal binding domain from HIV-1 matrix proteinXX
19606UBA Domain of Human NBR1XX
19608mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195XX
19609Protein-RNA Ternary ComplexXXX
19611Enzymatic cyclisation of kalata B1 using sortase AXX
19614basic-helix-loop-helix region of the transcriptional repressor HES-1XX
19616Dimethylarginine DimethylaminohydrolaseXX
19617Big domain from Leptospira interrogansXX
19618transport proteinXX
19620DNA duplex containing N3T-ethylene-N1IXX
19622PetF monomerXX
19623GA-79-MBP cs-rosetta structuresXX
19627hypothetical protein BACUNI 03114 from Bacteroides uniformis ATCC 8492XX
19628protein NP 419126.1 from CAULOBACTER CRESCENTUSXX
19632hypothetical protein BACUNI 03114 from Bacteroides uniformis ATCC 8492XX
19634CR4/5 domain of medaka telomerase RNAXX
19638cytochrome c Y67HXX
19642RBM39 RRM1XX
19654human Mcl-1XX
19657Penicillium Antifungal Protein PAFXX
19662I-V kissing-loop interaction of the Neurospora VS ribozymeXX
19664EcDsbA-sulfonamide complexXX
19667carboxyterminal domain of NusGXX
19668a3Y monomerXX
19669Ms-NbGRP2 monomerXX
19670lysine-free (K0) ubiquitinXX
19672Dok1 PTB domain monomerXX
19674CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10XX
19675CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44XX
19677CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4XX
19678CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5XX
19679CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7XX
19681E. coli LpoBXX
19682Zinc finger-PHD-type 1 domain number-1XX
19683S-linked glycopeptide sublancin 168XX
19685RRM3 intermediate stateXX
19687immune signalling subunitXX
19692Divalent Cations at the Active Site of the Neurospora VS RibozymeXX
19693oxidized dimeric form of human defensin 5XX
19694FHL2 LIM adaptor and its Interaction with SkiXX
19695N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAXX
19696N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAXX
19697novel venom peptide toxin from sample limited terebrid marine snailXX
19698preQ1 Class II riboswitch from Streptococcus pneumoniaeXX
19700P33A mutant of non-conventional toxin WTX from Naja kaouthiaXX
19702dimerization domain of the human polyoma, JC virus agnoproteinXX
19703Iron-sulfur cluster binding protein from Ehrlichia chaffeensisXX
19707extracellular sensor domain of DraK histidine kinaseXX
19710CDYL2 chromodomainXX
19711native split Npu DnaE inteinXX
19712Designed Exendin-4 analoguesXX
19713Domain-Swapped GLPGXX
19714Transport protein AXX
19715Receiver domain of ethylene receptor ETR1XX
19718Yah1 reducedXX
19720WT apo HasApXX
19721Y75A apo HasApXX
19722H83A apo HasApXX
19723Ig-alpha Ig-beta constructXX
19724Ig-alpha Ig-beta constructXX
19725Ig-alpha YE variant Ig-beta constructXX
19726GLD-1 KH-QUA2 bound to 5'-CUACUCAUAU-3'XXX
19727HIFABP Ketorolac complexXX
19730trimeric Skp with bound tOmpAXX
19731peptidyl-tRNA hyrolase from Vibrio choleraeXX
19732NLRC5 caspase recruitment domain (CARD)XX
19733trimeric SkpXX
19735TIA-1 RRM2,3 monomerXX
19737C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)XX
19739Calcium Bound S100P - V Domain of RAGE complexXX
19742Dimethylarginine DimethylaminohydrolaseXX
19743Pseudomonas aeruginosa Dimethylarginine DimethylaminohydrolaseXX
19744Pseudomonas aeruginosa Dimethylarginine DimethylaminohydrolaseXX
19745DNA (28-MER)XX
19746synthetic Mamba-1 peptideXX
19748Lactodifucotetraose (LDFT) beta anomerXX
19749N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1)XX
19750gp41 ectodomain monomer on a DPC micelleXX
19753Plectin repeat domain 6XX
19773E81 deletion mutant from RAP80 tandem UIMsXX
19774tandem UIMs of wild-type RAP80XX
19779Solution structure of the SGTA N-terminal domainXX
19783fourth constant immunoglobulin domain of nurse shark IgNARXX
19789N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin IXX
19791Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIHXX
197986aJL2-R24G Amyloidogenic Light Chain ProteinXX
19799LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalisXX
19803Anthrax Lethal Factor N-terminalXX
19806hypothetical protein ZP 02064002.1 from Bacteroides ovatus ATCC 8483XX
19807NMR structure of hypothetical protein ZP 02069618.1 from Bacteroides uniformis ATCC 8492.XX
19809YSCUCN in a micellar complex with SDSXX
19815COILED COIL DOMAIN OF Protein phosphatase 1 regulatory subunit 12AXX
19816C-domain of troponin C bound to the anchoring region of troponin IXX
19817mutation G159D in troponin C bound to the anchoring region of troponin IXX
19821Stf76 from the Sulfolobus islandicus plasmid-virus pSSVxXX
19822B25-(alpha, beta)-dehydro-phenylalanine insulinXX
19823Lasso Peptide Caulonodin VXX
19824Solution structure of a TrkAIg2 domain construct for use in drug discoveryXX
19834New Cyt-like delta-endotoxins from Dickeya dadantii - CytC proteinXX
19835E. coli Trigger Factor in complex with unfolded PhoA220-310XX
19836E. coli Trigger Factor in complex with unfolded PhoA1-150XX
19837E. coli Trigger Factor in complex with unfolded PhoA365-471XX
19841Ptr ToxBXX
19842eIF4G HEAT2 domainXX
19843ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholateXX
19845Coronavirus Envelope Proteins-1XX
19846alpha-amylase inhibitor peptide aS4 from Allatide scholarisXX
19847alpha amylase inhibitor peptide aS1 from Allatide scholarisXX
19849reduced BolA2 from Arabidopsis thalianaXX
19850GrxS14-BolA2 apo-heterodimer from Arabidopsis thalianaXX
19851Unknown protein YP 001712342.1 from Acinetobacter baumanniiXX
19853AGA modifiedXX
19859GK cecropin-like peptideXX
19860a ribosomal proteinXX
19861AGT FAPY Modified duplexXX
19862AGC FAPY modified duplex Major isomerXX
19863AG(7-deaza)G FAPY modified duplexXX
19864R1 peptideXX
19869ZapA homodimerXX
198706aJL2 Amyloidogenic Light Chain ProteinXX
19876YmoB. A modulator of biofilm formationXX
19881transport protein mXX
19887Oligonucleotide Model of the MiR-21 Pre-ElementXX
19893Q4D059, a hypothetical protein from Trypanosoma cruziXX
19901Thymosin alpha 1XX
19902P15 FLiPSXX
19904PPIase domain of TbPar42XX
19905phosphorylated 4E-BP2 monomerXX
19907L7Ae apoXX
19908L7Ae RNA complexXXX
19910P22S mutant of N-terminal CS domain of human Shq1XX
19915cold shock protein, TaCspXX
19916cold shock protein, TaCsp with dT7XX
19921hIFABP-oleate complexXX
19922TDP-43 RRM2XX
19930p38-0P apoXX
19934p38 2P apoXX
19935Dual-phosphorylated human p38 alpha ADP-boundXX
19936Dual-phosphorylated human p38 alpha MK2 334/D peptide boundXX
19937Dual-phosphorylated human p38 alpha ADP and MK2 334/D peptide boundXX
19938putative thioredoxin (ECH 0218) in the oxidized stateXX
19941TM domain of LAMP-2AXX
19942terminal Ig-like domain from Leptospira interrogans LigBXX
19943inner membrane protein YgaPXX
19946cytoplasmic rhodanese domain of the full-length inner membrane protein YgaPXX
19947Bitistatin AXX
19948S38-S107 peptide of 18.5 kDa MBPXX
19949MBP S38-S107 peptide in the presence of Fyn-SH3XX
19953V domain of RAGE in complex with IORXX
19955tandem SH3 domain of CAPXX
19960Human Chemokine CCL19XX
19962Truncated L126Z-sod1XX
19963Bitistatin BXX
19970Enterocin NKR-5-3BXX
19972MBP S72-S107 peptide in the presence of Fyn-SH3XX
19973potent antifungal peptide Cm-p5XX
19974BA42 proteinXX
19978[AibB8,LysB28,ProB29]-insulin analogueXX
19980CnA freeXX
19982NPM-N (Nucleophosmin) pentamerXX
19986Xenopus RecQ4 zinc knuckleXX
19989N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1XX
19994protein YgaP from Escherichia coliXX
19995LysRS Anticodon Binding Domain 72-207XX
19999osteopontin monomerXX
20010model peptide for INPXX
20022metastin analogXX
20026F proteinXX
20027brome mosaic virus protein 1aXX
20029Apelin 17XX
20030Apelin 17XX
20031Apelin 17XX
20036Cyclic PseudotetrapeptideXX
20037Cyclic PseudotetrapeptideXX
20038Cyclic PseudotetrapeptideXX
20039Cyclic PseudotetrapeptideXX
20040Cyclic PseudotetrapeptideXX
20041Cyclic PseudotetrapeptideXX
20042Cyclic PseudotetrapeptideXX
20043Cyclic PseudotetrapeptideXX
20044Interleukin-8 C-terminal domainXX
20050D-PAKKR monomerXX
20054KIA7W tetramerXX
20055KIA7H tetramerXX
20056LSEAL-CaMLD complexXX
20062Myelin Basic ProteinXX
20063Model PeptideXX
20081complex BK-PGGXX
20086nociceptin AntagonistXX
20087nociceptin analogueXX
20088nociceptin analogueXX
20089nociceptin analogueXX
20091rsv analogueXX
20093REV analogueXX
20094trans Pis-1[NkG]XX
20095cis Pis-1[NkG]XX
20098Pis-1 [PG]XX
20101Substance PXX
2010915-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)XX
20112Gaq-ct onlyXX
20115Substance PXX
20116Substance P in DMPC/CHAPS bicellesXX
20117Substance P in DMPC/CHAPS/GM1 bicellesXX
20118C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptorXX
20119thromboxane A2 receptorXX
20125VK22 in DPC micellesXX
20126Alpha-conotoxin Vc1.2XX
20127nociceptin AgonistXX
21000MccJ25 RGDXX
21002Tryptophan Zipper analogueXX
21010extended upainXX
21014conotoxin lt14aXX
21015conotoxin pu14aXX
21031Lewis aXX
21032SUGAR (3-MER)XX
21034Lewisx methyl glycosideXX
21036AIP-III D4A peptideXX
21038AIP-III DL7 peptideXX
21039AIP-III F5A peptideXX
21040AIP-III L7A peptideXX
21046AIP-II peptideXX
21047AIP-IV peptideXX
21053LDNF (trisaccharide)XX
21056SFTI-TCTR N12 N14 NMeSer6XX
21057SFTI-TCTR N12 N14XX
21062conotoxin Im10AXX
25000WW3 domain of Nedd4L in complex with its HECT domain PY motifXX
25009Cysteine Deleted Protegrin-1 (CDP-1): rr14XX
25011Cysteine Deleted Protegrin-1 (CDP-1): rr11XX
25012Cysteine Deleted Protegrin-1 (CDP-1): lr10XX
25014holo YqcAXX
25015holo FldAXX
25016Y125F mutant of eRF1 N-domainXX
25020E55Q mutant of eRF1 N-domainXX
25021ROQ domainXX
25022Polyglutamine binding peptide 1 (QBP1)XX
25023Drosophila ELF domain from FANCLXX
25026NMR structure of putative beta-lactamase (NP 372339.1) from Staphylococcus aureus Mu50XX
25027NMR structure of the hypothetical protein BVU 0925 from Bacteroides vulgatus ATCC 8482XX
25028NMR structure of the hypotheical protein Lreu 0056 from Lactobacillus reuteriXX
25030OMPA C-terminal domainXX
25032bacterial immunoglobulin-like domain form a surface protein of LeptospiraXX
25034cChimera Ca2+ boundXX
25035cChimeraX Ca2+ boundXX
25037N terminal domain of the MuB AAA+ ATPaseXX
25038hnRNP LXX
25039Second RNA Recognition Motif Domain of hnRNP LXX
25040most two C-terminal RNA Recognition Motif Domain of hnRNP LXX
25041First RNA Recognition Motif Domain of hnRNP L bound to CACACA RNAXXX
25042Second RNA Recognition Motif Domain of hnRNP L bound to ACACAC RNAXXX
25043Most two C-terminal RNA Recognition Motif Domain of hnRNP L bound to two equivalents ACACA RNAXXX
25049RNA (68-MER)XX
25052Nucleocapsid protein p10 and RNA (68-MER)XXX
25061Structure of De novo designed Protein OR457XX
25065PCP7T holo formXX
25067NESG Target OR459XX
25068High mobility group protein from Plasmodium falciparum 3D7XX
25069human Ca2+-loaded S100A4 cys-free mutantXX
25070Rad18-UBZ/ubiquitin complexXX
25077PTPN4 PDZ-linkerXX
25078CSD1-SXL-18-mer msl2 mRNAXX
25079human EpoRXX
25081Fyn SH2 boundXX
25082Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptideXX
25083Putative uncharacterized protein BTH I2711XX
25084Cdc5-D3 monomerXX
25085rhodanese domain of YgaPXX
25086truncated EcMazEXX
25092MazE-DNA bindingXXX
25093EcMazE homodimerXX
25094EcMazE homodimerXX
25096MciZ from Bacillus subtilisXX
25098copper binding protein in the apo formXX
25099Hs2 dimerXX
25100pf tRNApro:MLV-Nucleocapsid (1:2) ComplexXXX
25101tRNApro:MLV Nucleocapsid Protein (1:1) ComplexXXX
25110left-handed G-quadruplexXX
25124BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35CXX
25125Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35CXX
25130LEDGF/p75 IBD in complex with MLL1 peptide (140-160)XX
25131Kindlin-2 F2XX
25132VEEV macro domainXX
25135MLKL N-terminal domainXX
25137EL LovRXX
25139MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1XX
25141EL LovRXX
25142Hox homeodomainXX
25143RING finger of the tripartite 19XX
25145B1 box monomer of the tripartite 19XX
25146httNTQ30P10K2 fibrilsXX
25147DNA binding domain of sigma 54 from E.coliXX
25149Isolated Ring domainXX
25150human ubiquitin conjugating enzyme Ube2wXX
25152MTAbl13, a grafted MCoTI-IIXX
25153holo FldBXX
25154DMXAA-bound mSTING dimerXX
25155apo FldBXX
25156Decorin Binding Protein AXX
25157Decorin Binding Protein AXX
25158Doc48S monomerXX
25163three-way junction from the VS ribozymeXX
25164three-way junction from the VS ribozymeXX
25167Human Shq1 CS domainXX
25168flpp3Sol 2XX
25172Ca-bound hN-1 4-7XX
25177De Novo Designed Peptide that Sequesters Toxic Heavy MetalsXX
25188YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNAXXX
25195putative arsenate reductase from Brucella melitensisXX
25203Peptide of acidic-basic repeat antigen (ABRA) from Plasmodium falciparumXX
25208S100A4dC-MPT complexXX
25209synthetic peptide 36075XX
25218amyloid betaXX
25219UBM1 domain of human HUWE1/ARF-BP1XX
25221PHD domain of Yeast YNG2XX
25224human IgG-FcXX
25225trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)XX
25226cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)XX
25227aSyn WT monomerXX
25228aSyn H50Q monomerXX
25229Human FAAP20 UBZXX
25230Human FAAP20 UBZ-Ubiquitin ComplexXX
2523114-3-3 ZetaXX
25232F231L mutant ERCC1-XPF dimerization regionXX
25233S31N 19-49XX
25234M2 19-49XX
25238Human Relaxin-2XX
25240Twinstar from Drosophila melanogastorXX
25243Arsenate ReductaseXX
25244HuR RRM1 monomerXX
25247FliFc-FliG complexXX
25253Y99E,N111D CAM-iNOSXX
25257Y99E CAM-eNOSXX
25259hypothetical protein NP 344732.1 from Streptococcus pneumoniae TIGR4XX
25260human insulinXX
25261[GlnB22]-insulin mutantXX
25265Uncharacterized proteinXX
25266decorin binding protein BXX
25267TRIM25 (PRYSPRY) domainXX
25275eEF1Bdelta CAR domainXX
25276eEF1Bdelta CAR domain in TCTP-bound stateXX
25280mouse BMAL1 transactivation domainXX
25283scoloptoxin SSD609 from Scolopendra mutilansXX
25288TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)XX
25289amyloid-beta fibrils: the Osaka mutationXX
25293Kalata B7 Ser mutantXX
25294NP 809137.1 monomerXX
25298Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor proteinXX
25299Human Small Ubiquitin like Modifier protein-1 (SUMO-1)XX
25302Monomer of Mo3964XX
25303titin M10-obscurin-Ig1XX
25304obscurin Ig1 bound to titin M10XX
25305titin M10XX
25307SATB1 homeodomainXX
25308obscurin Ig58XX
25309FBP28 WW2 , mutation Y438RXX
25310FBP28 WW2 mutant Y446LXX
25311FBP28 WW2 mutant W457FXX
25313FBP28 WW2 mutant Y438R DNDCXX
25314FBP28 WW2 mutant Y438R L453A DNDCXX
25315FBP28 WW2 mutant Y438R DNXX
25317ACE-GLY-ASP-GLY-NH2 peptideXX
25318ACE-GLY-GLU-GLY-NH2 peptideXX
25319ACE-GLY-HIS-GLY-NH2 peptideXX
25320ACE-GLY-CYS-GLY-NH2 peptideXX
25321ACE-GLY-TYR-GLY-NH2 peptideXX
25322ACE-GLY-LYS-GLY-NH2 peptideXX
25326carboxy-terminal domain of DNTTIP1XX
25334Type 1 PilusXX
25342NMR structure of the protein YP 193882.1 from Lactobacillus acidophilus NCFM in presence of FMNXX
25343Talin-F3 / RIAM N-terminal Peptide complexXX
25344CaM Tr2C, monomerXX
25346MG200 EAGRboxXX
2534753BP1 tandem Tudor domains in complex with a p53K370me2 peptideXX
2534853BP1 tandem Tudor domains in complex with a p53K382me2 peptideXX
25350PsbQ from spinacia oleraceaXX
25351RING finger monomerXX
25352Acidocin BXX
25354Abp1p SH3 domainXX
25355EphB2 kinase domainXX
25356TPMT *1 16-245XX
25358periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factorXX
25363crotalicidin in DPC micellesXX
25368EF-GC3 monomerXX
25375PTP1B CPT-157633 ComplexXX
25376RING Domain of human Promyelocytic Leukemia Protein (PML)XX
25378A G-quadruplex structureXX
25382UBX-L domain of VCIP135XX
25383human TRAP1-NTDXX
25385Ssa1 substrate binding domainXX
25386zinc finger domainXX
25391tumor protein monomerXX
25393IST1 peptideXX
25395internal EH domain of gamma-synerginXX
25396mouse EpoRXX
25403Clathrin Heavy ChainXX
25408VG16KRKP, an antimicrobial peptide in D8PG micellesXX
25409VG16KRKP, an antimicrobial peptide in SDSXX
25416RNA (39-MER), 3' splice site in influenza A: 39-nt hairpinXX
25424DEFA1, a highly potent antimicrobial peptide from the horseXX
25425transforming growth factor beta induced protein (TGFBIp)XX
25428acidic domain of SYNCRIP (hnRNPQ)XX
25430GADD34 PP1 complexXX
25433RBM10 ZnF1XX
25435Amylase binding Protein AXX
25436hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNAXXX
25437Endo T5-ZN+2XX
25442Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Bud13p(215-255XX
25443Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Pml1p(22-42)XX
25448N-terminal domain of human TIG3XX
25449RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparumXX
25451dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei bruceiXX
25452Omega-Tbo-IT1 Selective Inhibitor of Insect Calcium ChannelsXX
25455cytochrome OmcFXX
25456Cullin3 - BTB interfaceXX
25457Cullin3 - BTB interfaceXX
25459Fungus protein Q8J180 MAGGRXX
25460Fungus protein B9WZW9 MAGORXX
25461CUE domain of yeast Cue1XX
25462NS1B ED mutant monomerXX
25463NS1B ED dimerXX
25464MbtH-like protein from Mycobacterium marinumXX
25469hnRNP C RRM in complex with 5'-UUUUC-3' RNAXXX
25475Tau(267-312) bound to MicrotubulesXX
25481perforin C2 quad mutantXX
25482GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY)XX
25484p300 Taz2-p53 TAD2 ComplexXX
25485PRO Form of Human Matrilysin (proMMP-7)XX
25486Purotoxin-2 in waterXX
25487Purotoxin-2 in DPC micellesXX
25488PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic MembraneXX
25489PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic MembraneXX
25490Conantokin Rl-BXX
25491Conantokin Rl-BXX
25494First and Second KH domains of hnRNP E1XX
25496RRM3 domain of Gbp2XX
25497RRM1 domain of Hrb1XX
25498RRM2 domain of Hrb1XX
25499RRM3 domain of Hrb1XX
25500SH2-SH3 adapter protein drkXX
25501SH2-SH3 adapter protein drkXX
25506Re-SDPhe-TATE isomer 1XX
25507Linear SDPhe-TATEXX
25508Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710bXX
25509APOBEC3G NTD variant, sNTDXX
25510AIM2 PYD from Mus musculusXX
25511cChimeraX-A162H, Ca2+ boundXX
25513TSPO A147T variant in complex with PK11195XX
25514phosphorylated J-domain of Human Cysteine String Protein (CSP)XX
25515non-phosphorylated J-domain of Human Cysteine String Protein (CSP)XX
25516Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1XX
25517Short hydrophobic peptide, 11merXX
25527alpha-crystallin domain from human, HSPB5XX
25529hylin a1XX
25533Ca-bound hN-1 8-11XX
25535alpha-synuclein fibrilsXX
25540NSsCT-Tfb1PH complexXX
25541MyUb (1080-1122) of human Myosin VIXX
25542MyUb (1080-1131) of human Myosin VIXX
25543human Myosin VI isoform3 (998-1071)XX
25544human Myosin VI isoform3 (1050-1131)XX
25545MyUb (1080-1122) of human Myosin VI with K63-diUbXX
25551Covalent, disulfide crosslink of V197C/C128A yeast cytochrome c peroxidase and A81C/C102T yeast iso-1 cytochrome cXX
25552PLK4-PB3 monomerXX
25554nucleotide-free Ran GTPaseXX
25556MRG15-MRGBP complexXX
25567YP 193882.1XX
25569PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptideXX
25576human SUMO1XX
25577human SUMO2XX
25582Protein and DNA complexXXX
25584complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)XX
25586wt NS4A N-terminal domain of DENVXX
25588High-affinity calmodulin complexes with vanilloid ligands of TRPV1XX
25590Fag s 1XX
25593HER2/ErbB2 dimeric transmembrane domainXX
25597Dynorphin 1-13 bound to Kappa Opioid ReceptorXX
25599Sds3 in complex with Sin3AXX
25600LigA4 Big domainXX
25601closed state of Lys63-linked diubiquitinXX
25610pheromone Ep-1 from Euplotes petziXX
25613[B26-B29 triazole cross-linked]-insulin analogueXX
25614insulin analogueXX
25615insulin analogueXX
25627meiosis-expressed gene 1 (Meig1)XX
25632TBD 1-22XX
25634ABD monomerXX
25636AVR-Pia monomerXX
25638C-terminal domain of the chromodomain helicase DNA-binding protein 1XX
25639LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)XX
25642cytoskeletal bactofilin BacAXX
25649Human Brd4 ET domain in complex with MLV Integrase C-termXX
25650RNA recognition motif-1 of serine/arginine-rich protein 1XX
25651active G-quadruplex motif from AGRO100XX
25652PTBRRM1-SL23H complexXXX
25654II-III-VI three-way junction from the VS ribozymeXX
25655II-III-VI three-way junction from the VS ribozyme in complex with MAGNESIUMXX
25657Proteasome protein fragmentXX
25659TDP-43 Amyloidogenic Core RegionXX
25660Y48pCMF variant of human cytochrome c in its reduced stateXX
25664NESG Target OR34XX
25667G335D Mutant of TDP-43 Amyloidogenic Core RegionXX
25668Q343R Mutant of TDP-43 Amyloidogenic Core RegionXX
25670Enterocin HFXX
25671HIV ISS elementXX
256733-stranded parallel beta-sheetXX
25674MALT1 subunit 1XX
25676NS4A mutXX
25677CBX8 in complex with AF9XX
25686G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genomeXX
25688Acyl Carrier Protein monomerXX
25690eukaryotic elongation factor 1B monomerXX
25702reduced form of thioredoxin 1 from Sacharomyces cerevisiaeXX
25703oxidized form of thioredoxin 1 from Sacharomyces cerevisiaeXX
25704lasso peptide chaxapeptinXX
25706VirA VirFG fusionXX
25707Ub in complex with parkin R0RBRXX
25708Ub S65EXX
25709Ub S65E in complex with parkin R0RBRXX
25710high-density lipoprotein particlesXX
25711HLA-B2705 TISXX
25712dehydroascorbate reductase 3A from Populus trichocarpaXX
25713HLA-B2709 pVIPRXX
25714HLA-B2705 pVIPRXX
25715HLA-B2709 TISXX
25716pyoluteorin type II pep-tidyl carrier protein PltL, holo formXX
25718Regnase-1 N-terminal domainXX
25719Regnase-1 Zinc finger domainXX
25720Regnase-1 C-terminal domainXX
25721VirA DDXX
25722KIAA0323 binding preference for NEDD8XX
25725cystein-rich peptide jS1XX
25729EGFR transmembrane and juxtamembrane domainsXX
25730H-Ras G12VXX
25738Re-SDPhe-TATE isomer 2XX
25739Re-SDPhe-TATE isomer 4XX
25740C-terminal domain of Cdc37 cochaperoneXX
25745N-terminal domain of the metalloprotease PrtV from Vibrio choleraeXX
25746DNA G-quadruplexXX
25750CIN85 CC-domain trimerXX
25753sweeter mutant (D40K) of sweet protein BrazzeinXX
25755non-sweet mutant (ins18RI19) of sweet protein BrazzeinXX
25758de-novo toxin Hui1XX
25759Quercetin complexed with c-myc G-quadruplex DNAXX
25763MbtH-like protein from Mycobacterium aviumXX
257642-stranded parallel beta-sheetXX
257652-stranded parallel beta-sheetXX
25767Vta1NTD-Did2(176-204) complexXX
25768Outer Membrane Protein G from Pseudomonas aeruginosaXX
25769frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2]XX
25770N Est2XX
25774spider toxin, U4-agatoxin-Ao1aXX
25776Outer Membrane Protein G P92A mutantXX
25777Tetrahymena telomerase RNA pseudoknotXX
25778spider toxin U4-hexatoxin-Hi1aXX
25779RRM2 monomerXX
25786holo ArCP from yersiniabactin synthetaseXX
25787salicylate-loaded ArCP from yersiniabactin synthetaseXX
25788Influenza-A M2XX
25789CmPI-II, a serin protease inhibitorXX
25790polyQ regulatory proteinXX
25791kinase in complex with its regulatory proteinXX
25794NESG Target OR446XX
25796complex of PEP-19 bound to the C-domain of apo calmodulinXX
25797cardiac troponin CXX
25798human Siglec-8XX
25799human I-type lectin domain-glycan complexXXX
25800Plasmodium falciparum SR1-RRM1 in complex with ACAUCA RNAXXX
25801UBL domain of the human DNA damage-inducible protein homolog 2XX
25803UBL domain of the yeast DNA damage-inducible protein homolog 1XX
25805cyclic nucleotide-binding homology domain of hERG channelXX
25806prolactin receptor transmembrane domainXX
25807B3 domain of protein GXX
25808KIAA0323 binding with NEDD8XX
25809W60G beta2-microglobulinXX
25810N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9XX
25811core of the U4/U6 di-snRNAXX
25813Peptide PG-989XX
25814Peptide PG-990 in DPC micellesXX
25817transmembrane domain of human nicastrin in SDS micellesXX
25818transmembrane domain of human nicastrin in DPC micellesXX
25820Peptide PG-990XX
25825UBL proteinXX
25826microRNA 20b pre-elementXX
25827metal-binding domain 1 of ATP7BXX
25829p75NTR DD:RhoGDIXX
25831complex of microRNA 20b pre-element with Rbfox RRMXXX
25834FHA domain of TbPar42XX
25835OtTx1a - AMP in DPC micellesXX
25836OtTx1a - ICKXX
25837chromodomain 3 (CD3) of cpSRP43XX
25838A3CT monomerXX
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dCXX
25847cyclic PVIIAXX
25848spider toxin pi-hexatoxin-Hi1aXX
25853spider toxin, U33-theraphotoxin-Cg1cXX
25856translation initiation factor from Staphylococcus aureus Mu50XX
25857Aureocin A53XX
25858Lacticin QXX
25859complex between MMP-12 and synthetic triple-helical collagenXX
25863ACT RTX domainXX
25867PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRESXX
25872TrkA transmembrane domainXX
25873RSK1 peptideXX
25877cecropin P1 with LPSXX
25881yeast Hit1 protein zinc fingerXX
25883DD homodimerXX
25886acyl carrier protein LipDXX
25887SLURP-2, a secreted isoform of Lynx1XX
25900NRAS Isoform 5XX
25902actinin-1 EF bound to IQXX
25903Glucose in a DNA double helix