Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25416
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chen, Jonathan; Kennedy, Scott; Turner, Douglas. "Structural features of a 3' splice site in influenza A
" Biochemistry 54, 3269-3285 (2015).
PubMed: 25909229
Assembly members:
RNA_(39-MER), polymer, 39 residues, 12688.705 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free Vector: pUC18
Entity Sequences (FASTA):
RNA_(39-MER): GGAUUUGCAGGCCUACCAGA
AACGGAUGGGAGUGCAGAU
| Data type | Count |
| 1H chemical shifts | 166 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity | 1 |
Entity 1, entity 39 residues - 12688.705 Da.
| 1 | G | G | A | U | U | U | G | C | A | G | ||||
| 2 | G | C | C | U | A | C | C | A | G | A | ||||
| 3 | A | A | C | G | G | A | U | G | G | G | ||||
| 4 | A | G | U | G | C | A | G | A | U |
sample_1: entity 1.1 mM; H2O 95%; D2O 5%
sample_conditions_1: ionic strength: 101.12 mM; pH: 6.0; pressure: 1 atm; temperature: 293.15 K
sample_conditions_2: ionic strength: 101.12 mM; pH: 6.0; pressure: 1 atm; temperature: 271.15 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
AMBER v11, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
SPARKY, Goddard - chemical shift assignment, data analysis, peak picking
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
VNMR, Varian - collection