Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6115
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Thiviyanathan, Varatharasa; Yang, Y.; Kaluarachchi, Kumaralal; Rijnbrand, R.; Gorenstein, D.; Lemon, S.. "High resolution Structure of a Picornaviral Internal Cis-acting RNA Replication Element (cre)" Proc. Natl. Acad. Sci. U.S.A. 101, 12688-12693 (2004).
PubMed: 15314212
Assembly members:
Cis-acting replication element, polymer, 34 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: viruses Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Cis-acting replication element: GGUCAUCGUUGAGAAAACGA
AACAGACGGUGGCC
| Data type | Count |
| 1H chemical shifts | 268 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | cre | 1 |
Entity 1, cre 34 residues - Formula weight is not available
| 1 | G | G | U | C | A | U | C | G | U | U | ||||
| 2 | G | A | G | A | A | A | A | C | G | A | ||||
| 3 | A | A | C | A | G | A | C | G | G | U | ||||
| 4 | G | G | C | C |
sample_1: Cis-acting replication element, [U-13C; U-15N], 0.8 2.0 mM
ex-cond_1: pH: 6.8; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H-15N HSQC | sample_1 | not available | ex-cond_1 |
FELIX v2000 - peak assignmnets, volume measurements