Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17961
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel. "Structure of the yeast U2/U6 snRNA complex." RNA 18, 673-683 (2012).
PubMed: 22328579
Assembly members:
U2U6111, polymer, 111 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free Vector: pUC19
Entity Sequences (FASTA):
U2U6111: GGCAAUACAGAGAUGAUCAG
CAGUUCCCCUGCAUAAGGAU
GAACCGUUUUACAAAGAGAU
UUCUUCGGGAAUCUCUUUGC
CUUUUGGCUUAGAUCAAGUG
UAGUAUCUGUC
Data type | Count |
15N chemical shifts | 54 |
1H chemical shifts | 140 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | U2U6111 | 1 |
Entity 1, U2U6111 111 residues - Formula weight is not available
1 | G | G | C | A | A | U | A | C | A | G | ||||
2 | A | G | A | U | G | A | U | C | A | G | ||||
3 | C | A | G | U | U | C | C | C | C | U | ||||
4 | G | C | A | U | A | A | G | G | A | U | ||||
5 | G | A | A | C | C | G | U | U | U | U | ||||
6 | A | C | A | A | A | G | A | G | A | U | ||||
7 | U | U | C | U | U | C | G | G | G | A | ||||
8 | A | U | C | U | C | U | U | U | G | C | ||||
9 | C | U | U | U | U | G | G | C | U | U | ||||
10 | A | G | A | U | C | A | A | G | U | G | ||||
11 | U | A | G | U | A | U | C | U | G | U | ||||
12 | C |
sample_1: U2U6111 0.6-0.8 mM; potassium phosphate 20 mM
sample_2: U2U6111, [U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura, 0.6-0.8 mM; potassium phosphate 20 mM
sample_3: U2U6111, [U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura, 0.3-0.5 mM; potassium phosphate 20 mM; magnesium chloride 2 mM
sample_4: U2U6111 0.6-0.8 mM; potassium phosphate 20 mM; magnesium chloride 2 mM
sample_5: U2U6111, [U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura, 0.3-0.5 mM; potassium phosphate 20 mM; magnesium chloride 2 mM; Pf1 phage 10 mg/ml
sample_conditions_1: ionic strength: 20 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HMQC | sample_2 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_1 |
2D 1H-15N HMQC | sample_4 | isotropic | sample_conditions_1 |
2D 1H-15N TROSY-HMQC | sample_2 | isotropic | sample_conditions_1 |
2D 1H-15N TROSY-HMQC | sample_4 | isotropic | sample_conditions_1 |
2D 1H-15N HMQC | sample_5 | anisotropic | sample_conditions_1 |
2D 1H-15N TROSY-HMQC | sample_5 | anisotropic | sample_conditions_1 |
SPARKY v3.114, Goddard - chemical shift assignment
TOPSPIN v2.1, Bruker Biospin - processing
MC-SYM v4.2.2, Parisien, Major - structure solution
X-PLOR NIH v2.21, Schwieters, Kuszewski, Tjandra and Clore - refinement