BMRB Entry 17568
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17568
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic H-T. "A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets." J. Biomol. NMR 52, 179-190 (2012).
PubMed: 22252483
Assembly members:
TASL3, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
TASL3: GGGAUUCAUGCACUUCGGAG
CAUGAAUCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 82 |
| 1H chemical shifts | 94 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | TASL3 | 1 |
Entities:
Entity 1, TASL3 30 residues - Formula weight is not available
| 1 | G | G | G | A | U | U | C | A | U | G | |
| 2 | C | A | C | U | U | C | G | G | A | G | |
| 3 | C | A | U | G | A | A | U | C | C | C |
Samples:
sample_1: TASL3 2 mM; D2O 100%
sample_2: TASL3 2 mM; H2O 95%; D2O 5%
sample_conditions_1: pH: 7.4; pressure: 1 atm; temperature: 303 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
Software:
TOPSPIN, Bruker Biospin - collection, processing
NMR spectrometers:
- Bruker Avance 700 MHz