Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52053
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Roy, Rohit; Geng, Ainan; Shi, Honglue; Merriman, Dawn; Dethoff, Elizabeth; Salmon, Loic; Al-Hashimi, Hashim. "Kinetic Resolution of the Atomic 3D Structures Formed by Ground and Excited Conformational States in an RNA Dynamic Ensemble" J. Am. Chem. Soc. 145, 22964-22978 (2023).
PubMed: 37831584
Assembly members:
entity_1, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCGAGCCUGGGGGCUCGCC
Data type | Count |
residual dipolar couplings | 15 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | A35G_monomer | 1 |
Entity 1, A35G_monomer 20 residues - Formula weight is not available
1 | G | G | C | G | A | G | C | C | U | G | |
2 | G | G | G | G | C | U | C | G | C | C |