BMRB Entry 52053

Name: Residual dipolar couplings measured on HIV-1 TAR ES1 mutant A35G using Pf1 phage alignment media for validating FARFAR-NMR ensemble
Published: 2023-07-26

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52053

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

Residual dipolar couplings measured on HIV-1 TAR ES1 mutant A35G using Pf1 phage alignment media for validating FARFAR-NMR ensemble

Deposition date:

2023-07-22

Original release date:

2023-07-26

Authors:

Roy, Rohit; Geng, Ainan; Shi, Honglue; Merriman, Dawn; Dethoff, Elizabeth; Salmon, Loic; Al-Hashimi, Hashim

Citation:

Citation: Roy, Rohit; Geng, Ainan; Shi, Honglue; Merriman, Dawn; Dethoff, Elizabeth; Salmon, Loic; Al-Hashimi, Hashim. "Kinetic Resolution of the Atomic 3D Structures Formed by Ground and Excited Conformational States in an RNA Dynamic Ensemble" J. Am. Chem. Soc. 145, 22964-22978 (2023).
PubMed: 37831584

Assembly members:

Assembly members:
entity_1, polymer, 20 residues, Formula weight is not available

Natural source:

Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1

Experimental source:

Experimental source: Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGCGAGCCUGGGGGCUCGCC

Data sets:

RDCs
- RDCs_1

Data type	Count
residual dipolar couplings	15

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	A35G_monomer	1

Entities:

Entity 1, A35G_monomer 20 residues - Formula weight is not available

1		G	G	C	G	A	G	C	C	U	G
2		G	G	G	G	C	U	C	G	C	C

Samples:

sample_1: A35G HIV-1 TAR RNA EII3 mutant 2 mM; D2O 10%; EDTA 0.1 mM; sodium chloride 25 mM; sodium phosphate 15 mM

sample_conditions_1: pH: 6.4; pressure: 1 atm; temperature: 298 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 13C-1H S3CT HSQC	sample_1	isotropic	sample_conditions_1
2D 13C-1H TROSY HSQC	sample_1	isotropic	sample_conditions_1
2D 13C-1H S3CT HSQC	sample_1	anisotropic	sample_conditions_1
2D 13C-1H TROSY HSQC	sample_1	anisotropic	sample_conditions_1

Software:

NMRPipe - data analysis

NMR spectrometers:

Bruker AVANCE III 800 MHz