Click here to enlarge.
PDB ID: 2mbj
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19402
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lim, Kah Wai; Ng, Veronica Chinn Min; Martin-Pintado, Nerea; Heddi, Brahim; Phan, Anh Tuan. "Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity." Nucleic Acids Res. 41, 10556-10562 (2013).
PubMed: 23999095
Assembly members:
DNA_(27-MER), polymer, 27 residues, 8592.441 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(27-MER): TTAGGGTTAGGGTTAGGGTT
AXGGTTA
Data type | Count |
1H chemical shifts | 229 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | DNA (27-MER) | 1 |
Entity 1, DNA (27-MER) 27 residues - 8592.441 Da.
1 | DT | DT | DA | DG | DG | DG | DT | DT | DA | DG | ||||
2 | DG | DG | DT | DT | DA | DG | DG | DG | DT | DT | ||||
3 | DA | BGM | DG | DG | DT | DT | DA |