BMRB Entry 19662

Title:
NMR structure of the I-V kissing-loop interaction of the Neurospora VS ribozyme   PubMed: 24325625
Deposition date:
2013-12-05
Original release date:
2014-01-10
Authors:
Bouchard, Patricia; Legault, Pascale
Citation:

Citation: Bouchard, Patricia; Legault, Pascale. "Structural insights into substrate recognition by the neurospora varkud satellite ribozyme: importance of u-turns at the kissing-loop junction."  Biochemistry 53, 258-269 (2014).

Assembly members:

Assembly members:
RNA_(5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), polymer, 22 residues, 7049.290 Da.
RNA_(5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), polymer, 21 residues, 6721.066 Da.

Natural source:

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: enzymatic semisynthesis

Experimental source:

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
RNA_(5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'): GAGCAGCAUCGUCGGCUGCU CA
RNA_(5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'): GCGGCAGUUGACUACUGUCG C

Data sets:
Data typeCount
13C chemical shifts186
15N chemical shifts67
1H chemical shifts231

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3')1
2RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3')2

Entities:

Entity 1, RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3') 22 residues - 7049.290 Da.

1   GAGCAGCAUC
2   GUCGGCUGCU
3   CA

Entity 2, RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3') 21 residues - 6721.066 Da.

1   GCGGCAGUUG
2   ACUACUGUCG
3   C

Samples:

sample_1: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3')1.3 – 2.2 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), [U-15N], 1.3 – 2.2 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_2: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3') 1.5 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), [U-13C; U-15N], 1.5 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_3: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), [U-15N], 1.4 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3') 1.4 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_4: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), [U-13C; U-15N], 1.7 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3') 1.7 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_5: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), [U-13C; U-15N]-Gua, 1.4 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3') 1.4 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_6: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), [U-13C; U-15N]-Gua, 1.4 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3') 1.4 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_7: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), [U-15N], 1.4 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3') 1.4 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_8: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3') 1.3 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), [U-15N], 1.3 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_9: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), [U-13C; U-15N], 1.7 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3') 1.7 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_10: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3') 1.5 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), [U-13C; U-15N], 1.5 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM

sample_11: RNA (5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), [U-15N], 0.2 – 0.3 mM; RNA (5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), [U-15N], 0.2 – 0.3 mM; TRIS, [U-2H], 10 mM; sodium chloride 50 mM; sodium azide 0.05 mM; magnesium chloride 5 mM; Pf1 phage 14.6-20.5 mg/mL

sample_conditions_1: ionic strength: 55 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 55 mM; pH: 7.0; pressure: 1 atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlysample_1isotropicsample_conditions_1
2D 1H-15N HSQC NH2 onlysample_3isotropicsample_conditions_1
2D 1H-15N NHH COSYsample_1isotropicsample_conditions_1
2D 1H-15N NHH COSYsample_3isotropicsample_conditions_1
2D 1H-15N HMQC J=21Hzsample_7isotropicsample_conditions_1
2D 1H-15N HMQC J=21Hzsample_8isotropicsample_conditions_1
2D 1H-15N CPMG NOESYsample_1isotropicsample_conditions_2
2D 1H-15N CPMG NOESYsample_3isotropicsample_conditions_2
2D 1H-1H flip-back watergate NOESYsample_3isotropicsample_conditions_1
3D 15N-edited NOESY-HSQCsample_1isotropicsample_conditions_1
3D 15N-edited NOESY-HSQCsample_3isotropicsample_conditions_1
2D 1H-13C CT-HSQCsample_2isotropicsample_conditions_1
2D 1H-13C CT-HSQCsample_4isotropicsample_conditions_1
2D 1H-13C CT-HSQCsample_5isotropicsample_conditions_1
2D 1H-13C CT-HSQCsample_6isotropicsample_conditions_1
3D 15N/13C-edited NOESY-HSQCsample_9isotropicsample_conditions_1
3D 15N/13C-edited NOESY-HSQCsample_10isotropicsample_conditions_1
3D 13C-edited HMQC-NOESYsample_2isotropicsample_conditions_1
3D 13C-edited HMQC-NOESYsample_4isotropicsample_conditions_1
3D 13C-edited HMQC-NOESYsample_5isotropicsample_conditions_1
3D 13C-edited HMQC-NOESYsample_6isotropicsample_conditions_1
3D HCCH-COSYsample_2isotropicsample_conditions_1
3D HCCH-COSYsample_4isotropicsample_conditions_1
3D HCCH-COSYsample_6isotropicsample_conditions_1
1D 15N-decoupled 1H watergatesample_1isotropicsample_conditions_1
1D 15N-decoupled 1H watergatesample_3isotropicsample_conditions_1
1D 15N-filtered 1H watergatesample_1isotropicsample_conditions_1
1D 15N-filtered 1H watergatesample_3isotropicsample_conditions_1
1D 15N-edited 1H watergatesample_1isotropicsample_conditions_1
1D 15N-edited 1H watergatesample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_11anisotropicsample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

PyMOL, Schrodinger - Structure analysis, Structure display

CCPNMR_suite, CCPN - chemical shift assignment, data analysis, peak picking

CURVES_+, (CURVES) Lavery, R., Moakher, M., Maddocks, J.H., Petkeviciute, D. and Zakrzewska, K. - Structure analysis

NMR spectrometers:

  • Varian INOVA 500 MHz
  • Varian INOVA 600 MHz