Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50069
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Yanjiao; Han, Ge; Jiang, Xiuying; Yuwen, Tairan; Xue, Yi. "Chemical shift prediction of RNA imino groups: application toward characterizing RNA excited states
" Nat. Commun. 12, 1595-1595 (2021).
PubMed: 33707433
Assembly members:
hairpin RNA PL01, polymer, 29 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: in vitro transcription
Entity Sequences (FASTA):
hairpin RNA PL01: GGGCCUGCCGGAAACGUUCC
GGUAGGCCC
| Data type | Count |
| 15N chemical shifts | 12 |
| 1H chemical shifts | 12 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | PL01 | 1 |
Entity 1, PL01 29 residues - Formula weight is not available
| 1 | G | G | G | C | C | U | G | C | C | G | ||||
| 2 | G | A | A | A | C | G | U | U | C | C | ||||
| 3 | G | G | U | A | G | G | C | C | C |
sample_1: RNA(30-mer) 4.02 mM; sodium phosphate 10 mM; EDTA 0.01 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 283.15 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN, Bruker Biospin - collection
SPARKY, Goddard - chemical shift assignment, peak picking
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing