Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50378
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Platella, Chiara; Trajkovski, Marko; Doria, Filippo; Freccero, Mauro; Plavec, Janez; Montesarchio, Daniela. "On the interaction of an anticancer trisubstituted naphthalene diimide with G-quadruplexes of different topologies: a structural insight" Nucleic Acids Res. 48, 12380-12393 (2020).
PubMed: 33170272
Assembly members:
entity_1, polymer, 20 residues, Formula weight is not available
entity_2, polymer, 20 residues, Formula weight is not available
entity_3, polymer, 20 residues, Formula weight is not available
entity_4, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TAGGGACGGGCGGGCAGGGT
entity_2: TAGGGXXGGGCGGGCAGGGT
entity_3: TAGGGACGGGCGGGXXGGGT
entity_4: TAGGGXXGGGCGGGXXGGGT
| Data type | Count |
| 1H chemical shifts | 763 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | M2+NDI-5 | 1 |
| 2 | M2-L1+NDI-5 | 2 |
| 3 | M2-L3+NDI-5 | 3 |
| 4 | M2-L1L3+NDI-5 | 4 |
Entity 1, M2+NDI-5 20 residues - Formula weight is not available
| 1 | DT | DA | DG | DG | DG | DA | DC | DG | DG | DG | |
| 2 | DC | DG | DG | DG | DC | DA | DG | DG | DG | DT |
Entity 2, M2-L1+NDI-5 20 residues - Formula weight is not available
| 1 | DT | DA | DG | DG | DG | 3DR | 3DR | DG | DG | DG | |
| 2 | DC | DG | DG | DG | DC | DA | DG | DG | DG | DT |
Entity 3, M2-L3+NDI-5 20 residues - Formula weight is not available
| 1 | DT | DA | DG | DG | DG | DA | DC | DG | DG | DG | |
| 2 | DC | DG | DG | DG | 3DR | 3DR | DG | DG | DG | DT |
Entity 4, M2-L1L3+NDI-5 20 residues - Formula weight is not available
| 1 | DT | DA | DG | DG | DG | 3DR | 3DR | DG | DG | DG | |
| 2 | DC | DG | DG | DG | 3DR | 3DR | DG | DG | DG | DT |
sample_1: M2 G-quadruplex 0.2 mM; M2-L1 G-quadruplex 0.2 mM; M2-L3 G-quadruplex 0.2 mM; M2-L1L3 G-quadruplex 0.2 mM; KCl 100 mM; potassium phosphate buffer 20 mM
sample_conditions_1: ionic strength: 0.120 M; pH: 7; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
SPARKY - chemical shift assignment