BMRB Entry 5852

Title:
NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site
Deposition date:
2003-06-27
Original release date:
2003-09-12
Authors:
Hoffmann, B.; Mitchell, G.; Gendron, P.; Major, F.; Andersen, A.; Collins, R.; Legault, P.
Citation:

Citation: Hoffmann, B.; Mitchell, G.; Gendron, P.; Major, F.; Andersen, A.; Collins, R.; Legault, P.. "NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site "  Proc. Natl. Acad. Sci. U. S. A. 100, 7003-7008 (2003).
PubMed: 12782785

Assembly members:

Assembly members:
A mimic of the VS Ribozyme Hairpin Substrate, polymer, 23 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
A mimic of the VS Ribozyme Hairpin Substrate: GAGCGAAGACGAAAGUCGAG CUC

Data sets:
Data typeCount
13C chemical shifts153
15N chemical shifts69
1H chemical shifts212

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1SL11

Entities:

Entity 1, SL1 23 residues - Formula weight is not available

1   GAGCGAAGAC
2   GAAAGUCGAG
3   CUC

Samples:

sample_1: A mimic of the VS Ribozyme Hairpin Substrate, [U-98% 13C; U-98% 15N], 1.1 mM; D11-TRIS 10 mM; NaCl 50 mM; EDTA 0.2 mM; NaN3 0.05 mM; H2O 90%; D2O 10%

sample_2: A mimic of the VS Ribozyme Hairpin Substrate, [U-98% 13C; U-98% 15N], 1.1 mM

sample_3: A mimic of the VS Ribozyme Hairpin Substrate, [U-95% 15N], 1.7 mM

sample_4: A mimic of the VS Ribozyme Hairpin Substrate, [U-98% 15N], 5.3 mM

sample_cond_1: ionic strength: 50 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D DQF COSYnot availablenot availablenot available
2D 15N HSQC (imino optimized)not availablenot availablenot available
2D 15N HSQC (amino optimized)not availablenot availablenot available
2D 13C constant-time HSQCnot availablenot availablenot available
2D 13C long range HSQCnot availablenot availablenot available
2D A-specific (H)N(C)-TOCSY-(C)Hnot availablenot availablenot available
2D C-specific H(NCCC)Hnot availablenot availablenot available
2D G-specific H(NC)-TOCSY-(C)Hnot availablenot availablenot available
2D U-specific H(NCCC)Hnot availablenot availablenot available
2D 1H-15N MQ-(HC)N(C)Hnot availablenot availablenot available
2D HNN-COSYnot availablenot availablenot available
2D H(CN)N(H)not availablenot availablenot available
3D HCCH-COSYnot availablenot availablenot available
3D HCCH-TOCSYnot availablenot availablenot available
2D watergate NOESYnot availablenot availablenot available
2D 15N CPMG-NOESYnot availablenot availablenot available
3D 13C/15N-edited HSQC-NOESYnot availablenot availablenot available
3D 13C-edited HMQC-NOESYnot availablenot availablenot available

Software:

NMRPipe v2.1 - processing

NMRView v5.03 - data analysis

X-PLOR v3.840 - refinement, structure calculation

Molmol v2K.1 - data analysis

NMRDraw - processing

NMR spectrometers:

  • Varian INOVA 600 MHz