BMRB Entry 5852

Click here to enlarge.

PDB ID: 1ow9
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5852
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Title:
NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site
Deposition date:
2003-06-27
Original release date:
2003-09-12
Authors:
Hoffmann, B.; Mitchell, G.; Gendron, P.; Major, F.; Andersen, A.; Collins, R.; Legault, P.
Citation:

Citation: Hoffmann, B.; Mitchell, G.; Gendron, P.; Major, F.; Andersen, A.; Collins, R.; Legault, P.. "NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site"  Proc. Natl. Acad. Sci. U. S. A. 100, 7003-7008 (2003).
PubMed: 12782785

Assembly members:

Assembly members:
A mimic of the VS Ribozyme Hairpin Substrate, polymer, 23 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: Neurospora crassa   Taxonomy ID: 5141   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Neurospora crassa

Experimental source:

Experimental source:   Production method: cell free synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
A mimic of the VS Ribozyme Hairpin Substrate: GAGCGAAGACGAAAGUCGAG CUC

Data sets:
Data typeCount
13C chemical shifts153
15N chemical shifts69
1H chemical shifts212

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1SL11

Entities:

Entity 1, SL1 23 residues - Formula weight is not available

1   GAGCGAAGAC
2   GAAAGUCGAG
3   CUC