Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5852
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Hoffmann, B.; Mitchell, G.; Gendron, P.; Major, F.; Andersen, A.; Collins, R.; Legault, P.. "NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme
Cleavage Site
" Proc. Natl. Acad. Sci. U. S. A. 100, 7003-7008 (2003).
PubMed: 12782785
Assembly members:
A mimic of the VS Ribozyme Hairpin Substrate, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: Neurospora crassa Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Neurospora crassa
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
A mimic of the VS Ribozyme Hairpin Substrate: GAGCGAAGACGAAAGUCGAG
CUC
| Data type | Count |
| 13C chemical shifts | 153 |
| 15N chemical shifts | 69 |
| 1H chemical shifts | 212 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | SL1 | 1 |
Entity 1, SL1 23 residues - Formula weight is not available
| 1 | G | A | G | C | G | A | A | G | A | C | ||||
| 2 | G | A | A | A | G | U | C | G | A | G | ||||
| 3 | C | U | C |
sample_1: A mimic of the VS Ribozyme Hairpin Substrate, [U-98% 13C; U-98% 15N], 1.1 mM; D11-TRIS 10 mM; NaCl 50 mM; EDTA 0.2 mM; NaN3 0.05 mM; H2O 90%; D2O 10%
sample_2: A mimic of the VS Ribozyme Hairpin Substrate, [U-98% 13C; U-98% 15N], 1.1 mM
sample_3: A mimic of the VS Ribozyme Hairpin Substrate, [U-95% 15N], 1.7 mM
sample_4: A mimic of the VS Ribozyme Hairpin Substrate, [U-98% 15N], 5.3 mM
sample_cond_1: ionic strength: 50 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D DQF COSY | not available | not available | not available |
| 2D 15N HSQC (imino optimized) | not available | not available | not available |
| 2D 15N HSQC (amino optimized) | not available | not available | not available |
| 2D 13C constant-time HSQC | not available | not available | not available |
| 2D 13C long range HSQC | not available | not available | not available |
| 2D A-specific (H)N(C)-TOCSY-(C)H | not available | not available | not available |
| 2D C-specific H(NCCC)H | not available | not available | not available |
| 2D G-specific H(NC)-TOCSY-(C)H | not available | not available | not available |
| 2D U-specific H(NCCC)H | not available | not available | not available |
| 2D 1H-15N MQ-(HC)N(C)H | not available | not available | not available |
| 2D HNN-COSY | not available | not available | not available |
| 2D H(CN)N(H) | not available | not available | not available |
| 3D HCCH-COSY | not available | not available | not available |
| 3D HCCH-TOCSY | not available | not available | not available |
| 2D watergate NOESY | not available | not available | not available |
| 2D 15N CPMG-NOESY | not available | not available | not available |
| 3D 13C/15N-edited HSQC-NOESY | not available | not available | not available |
| 3D 13C-edited HMQC-NOESY | not available | not available | not available |
NMRPipe v2.1 - processing
NMRView v5.03 - data analysis
X-PLOR v3.840 - refinement, structure calculation
Molmol v2K.1 - data analysis
NMRDraw - processing