Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25049
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Miller, Sarah; Yildiz, F.; Lo, Jennifer; Wang, Bo; D'Souza, Victoria. "A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing" Nature 515, 591-595 (2014).
Assembly members:
RNA_(68-MER), polymer, 68 residues, 21894.025 Da.
Natural source: Common Name: Murine Leukemia Virus Taxonomy ID: 11786 Superkingdom: Viruses Kingdom: not available Genus/species: Gammaretrovirus not available
Experimental source: Production method: recombinant technology Host organism: in vitro transcription Vector: pNCA
Natural source: Common Name: Murine Leukemia Virus Taxonomy ID: 11786 Superkingdom: Viruses Kingdom: not available Genus/species: Gammaretrovirus not available
Experimental source: Production method: recombinant technology Host organism: in vitro transcription Vector: pNCA
Entity Sequences (FASTA):
RNA_(68-MER): GGGCGAGGGUCUCCUCUGAG
UGAUUGACUACCCGUCAGCG
GGGGUCUUUCAUUUGGGGGC
UCGUGCCC
Data type | Count |
13C chemical shifts | 296 |
15N chemical shifts | 27 |
1H chemical shifts | 397 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (68-MER) | 1 |
Entity 1, RNA (68-MER) 68 residues - 21894.025 Da.
1 | G | G | G | C | G | A | G | G | G | U | ||||
2 | C | U | C | C | U | C | U | G | A | G | ||||
3 | U | G | A | U | U | G | A | C | U | A | ||||
4 | C | C | C | G | U | C | A | G | C | G | ||||
5 | G | G | G | G | U | C | U | U | U | C | ||||
6 | A | U | U | U | G | G | G | G | G | C | ||||
7 | U | C | G | U | G | C | C | C |
sample_1: U5-PBS, [U-100% 13C; U-100% 15N], 0.8 mM; Tris 10 mM; NaCl 10 mM; D2O 100%
sample_conditions_1: ionic strength: 20 mM; pH: 7.2; pressure: 1 atm; temperature: 311 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESYin H2O | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESYin D2O | sample_1 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
CYANA, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax, Guntert, Mumenthaler and Wuthrich, Johnson, One Moon Scientific - data analysis, processing, structure solution