Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25811
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Cornilescu, Gabriel; Didychuk, Allison; Rodgers, Margaret; Michael, Lauren; Burke, Jordan; Montemayor, Eric; Hoskins, Aaron; Butcher, Samuel. "Structural analysis of multi-helical RNAs by NMR-SAXS/WAXS: Application to the U4/U6 di-snRNA
" J. Mol. Biol. 428, 777-789 (2015).
PubMed: 26655855
Assembly members:
RNA_(92-MER), polymer, 92 residues, 29563.637 Da.
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pUC19
Entity Sequences (FASTA):
RNA_(92-MER): GGCCUUAUGCACGGGAAAUA
CGCAUAUCAGUGAGGAUUCG
UCCGAGAUUGUGUUUUUGCU
GGUGUAAAUCAGCAGUUCCC
CUGCAUAAGGCU
| Data type | Count |
| 13C chemical shifts | 5 |
| 15N chemical shifts | 25 |
| 1H chemical shifts | 30 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (92-MER) | 1 |
Entity 1, RNA (92-MER) 92 residues - 29563.637 Da.
Contains two G nucleotides for transcription, then snRNA U4 nucleotides 3-63, a GUAA linker, U6 snRNA nucleotides 56-80 with an A79C mutation.
| 1 | G | G | C | C | U | U | A | U | G | C | ||||
| 2 | A | C | G | G | G | A | A | A | U | A | ||||
| 3 | C | G | C | A | U | A | U | C | A | G | ||||
| 4 | U | G | A | G | G | A | U | U | C | G | ||||
| 5 | U | C | C | G | A | G | A | U | U | G | ||||
| 6 | U | G | U | U | U | U | U | G | C | U | ||||
| 7 | G | G | U | G | U | A | A | A | U | C | ||||
| 8 | A | G | C | A | G | U | U | C | C | C | ||||
| 9 | C | U | G | C | A | U | A | A | G | G | ||||
| 10 | C | U |
sample_1A: RNA (92-MER), [U-13C; U-15N]-Gua, -Ura, 0.6 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM
sample_2A: RNA (92-MER), [U-13C; U-15N]-Ade, 0.7 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM
sample_1B: RNA (92-MER), [U-13C; U-15N]-Gua, -Ura, 0.6 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM; Pf1 phage 5 mg/mL
sample_2B: RNA (92-MER), [U-13C; U-15N]-Ade, 0.7 mM; potassium chloride 0.02 mM; potassium phosphate 0.02 mM; Pf1 phage 5 mg/mL
sample_conditions_1: ionic strength: 58.5 mM; pH: 7.0; pressure: 1 atm; temperature: 273 K
sample_conditions_2: ionic strength: 58.5 mM; pH: 7.0; pressure: 1 atm; temperature: 273 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1A | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1B | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2A | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_2B | anisotropic | sample_conditions_2 |
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement
NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - peak picking