BMRB Entry 26505
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26505
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Shajani, Zahra; Varani, Gabriele. "13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA" J. Mol. Biol. 349, 699-715 (2005).
PubMed: 15890361
Assembly members:
3'-UTR, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
3'-UTR: GGCAGAGUCCUUCGGGACAU
UGCACCUGCC
- heteronucl_NOEs
- heteronucl_T1_relaxation
- heteronucl_T1rho_relaxation
- order_parameters
| Data type | Count |
| heteronuclear NOE values | 97 |
| T1 relaxation values | 98 |
| T1rho relaxation values | 98 |
| order parameters | 65 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 3'-untranslated region | 1 |
Entities:
Entity 1, 3'-untranslated region 30 residues - Formula weight is not available
| 1 | G | G | C | A | G | A | G | U | C | C | |
| 2 | U | U | C | G | G | G | A | C | A | U | |
| 3 | U | G | C | A | C | C | U | G | C | C |