Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26505
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Shajani, Zahra; Varani, Gabriele. "13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA" J. Mol. Biol. 349, 699-715 (2005).
PubMed: 15890361
Assembly members:
3'-UTR, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
3'-UTR: GGCAGAGUCCUUCGGGACAU
UGCACCUGCC
| Data type | Count |
| heteronuclear NOE values | 97 |
| T1 relaxation values | 98 |
| T1rho relaxation values | 98 |
| order parameters | 65 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 3'-untranslated region | 1 |
Entity 1, 3'-untranslated region 30 residues - Formula weight is not available
| 1 | G | G | C | A | G | A | G | U | C | C | |
| 2 | U | U | C | G | G | G | A | C | A | U | |
| 3 | U | G | C | A | C | C | U | G | C | C |
sample_1: 3'-UTR, [U-13C; U-15N], 0.7 mM; potassium phosphate 10 mM; EDTA .01 mM; H2O 99.9 v/v; D20 .1 v/v
sample_2: 3'-UTR, [U-13C; U-15N], 1.0 mM; potassium phosphate 10 mM; EDTA .01 mM; H2O 99.9 v/v; D20 .1 v/v
sample_conditions_1: temperature: 298 K; pH: 6.0; pressure: 1.0 atm
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 13C-{1H} NOE | sample_1 | isotropic | sample_conditions_1 |
| 13C-{1H} NOE | sample_1 | isotropic | sample_conditions_1 |
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
ModelFree, Palmer - data analysis