Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26024
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Gu, Xiaobo; Park, Sun-Young; Tonelli, Marco; Cornilescu, Gabriel; Xia, Tianbing; Zhong, Dongping; Schroeder, Susan. "NMR Structures and Dynamics in a Prohead RNA Loop that Binds Metal Ions
" J. Phys. Chem. Lett. ., 3841-3846 (2016).
PubMed: 27631837
Assembly members:
RNA_(28-MER), polymer, 28 residues, 8970.434 Da.
Natural source: Common Name: bacteriophage Taxonomy ID: 38018 Superkingdom: Viruses Kingdom: not available Genus/species: not available unidentified phage
Experimental source: Production method: enzymatic semisynthesis Host organism: Transcription of RNA using T7 polymerase Vector: Transcription of RNA using T7 polymerase
Entity Sequences (FASTA):
RNA_(28-MER): GGACGUUAAAAGGCUUCGGC
CUACGUCC
| Data type | Count |
| 13C chemical shifts | 78 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 184 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (28-MER) | 1 |
Entity 1, RNA (28-MER) 28 residues - 8970.434 Da.
| 1 | G | G | A | C | G | U | U | A | A | A | ||||
| 2 | A | G | G | C | U | U | C | G | G | C | ||||
| 3 | C | U | A | C | G | U | C | C |
AU_label: RNA (28-MER), [U-98% 13C; U-98% 15N]-A,U, 1.5 mM; cobalt hexamine 1.5 mM; sodium chloride 10 mM; sodium phosphate 10 mM
NO_label: RNA (28-MER) 1 mM; cobalt hexamine 1 mM; sodium chloride 10 mM; sodium phosphate 10 mM
AU_label_RDC: RNA (28-MER), [U-98% 13C; U-98% 15N]-A,U, 1.5 mM; cobalt hexamine 1.5 mM; phage 5 mg/mL; sodium chloride 10 mM; sodium phosphate 10 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 20 mM; pH: 6; pressure: 1 bar; temperature: 274 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HSQC | AU_label | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | AU_label | isotropic | sample_conditions_1 |
| 2D NOESY13CHSQC | AU_label | isotropic | sample_conditions_1 |
| 2D HCNTROSY | AU_label | isotropic | sample_conditions_1 |
| 2D NOESY | AU_label | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | AU_label_RDC | isotropic | sample_conditions_1 |
| 2D NOESY | NO_label | isotropic | sample_conditions_2 |
| 2D COSY | NO_label | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | NO_label | isotropic | sample_conditions_1 |
SPARKY, Goddard - chemical shift assignment
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement