BMRB Entry 18893

Title:
NMR solution structure of the d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1   PubMed: 24448450
Deposition date:
2012-12-12
Original release date:
2013-12-16
Authors:
Kruschel, Daniela; Skilandat, Miriam; Sigel, Roland
Citation:

Citation: Kruschel, Daniela; Skilandat, Miriam; Sigel, Roland. "NMR structure of the 5'-splice site in the group IIB intron Sc.ai5--conformational requirements for exon-intron recognition."  RNA ., .-. (2014).

Assembly members:

Assembly members:
RNA_(29-MER), polymer, 29 residues, 9301.611 Da.
RNA_(7-MER), polymer, 7 residues, 2197.370 Da.

Natural source:

Natural source:   Common Name: baker's yeast   Taxonomy ID: 4932   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Saccharomyces cerevisiae

Experimental source:   Production method: cell free synthesis   Host organism: not applicable   Vector: not applicable

Experimental source:

Natural source:   Common Name: baker's yeast   Taxonomy ID: 4932   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Saccharomyces cerevisiae

Experimental source:   Production method: cell free synthesis   Host organism: not applicable   Vector: not applicable

Entity Sequences (FASTA):

Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA GCAUACUCC
RNA_(7-MER): CAGUGUC

Data sets:
Data typeCount
13C chemical shifts78
15N chemical shifts13
1H chemical shifts306

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (29-MER)1
2RNA_(7-MER)2

Entities:

Entity 1, RNA (29-MER) 29 residues - 9301.611 Da.

part of intron domain one; postion 5-25 correspond to 315-335 on Sc.ai5gamma intron (25657-25677 on gene); extended by 4 nt on each side

1   GGAGUAUGUA
2   UUGGCACUGA
3   GCAUACUCC

Entity 2, RNA_(7-MER) 7 residues - 2197.370 Da.

sequence corresponds to the last 7 nt of the 5' exon (position 25336-25342 in gene)

1   CAGUGUC

Samples:

unlabelled_d2o: RNA (29-MER)0.5 – 0.9 mM; RNA_(7-MER)0.5 – 0.9 mM; potassium chloride 110 mM; EDTA 10 uM; D2O 100%

unlabelled_h2o: RNA (29-MER)0.5 – 0.9 mM; RNA_(7-MER)0.5 – 0.9 mM; potassium chloride 110 mM; EDTA 10 uM; D2O 10%; H2O 90%

labelled_d2o: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.5 mM; RNA_(7-MER) 0.5 mM; potassium chloride 110 mM; EDTA 10 uM; D2O 100%

labelled_h2o: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.5 mM; RNA_(7-MER) 0.5 mM; potassium chloride 110 mM; EDTA 10 uM; D2O 10%; H2O 90%

deuterated_d2o: RNA (29-MER), [3',4',5',5'',5-100% 2H], 0.6 mM; RNA_(7-MER) 0.6 mM; potassium chloride 110 mM; EDTA 10 uM; D2O 100%

labelled_h2o_phage: RNA (29-MER), [U-100% 13C; U-100% 15N], 0.5 mM; RNA_(7-MER) 0.5 mM; potassium chloride 110 mM; EDTA 10 uM; Pf1 phage 25.6 mg/mL; D2O 10%; H2O 90%

d2o_298K: ionic strength: 110 mM; pD: 6.8; pressure: 1 atm; temperature: 298 K

h2o_278K: ionic strength: 110 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K

h2o_293K: ionic strength: 110 mM; pH: 6.8; pressure: 1 atm; temperature: 293 K

h2o_298K: ionic strength: 110 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYunlabelled_d2oisotropicd2o_298K
2D 1H-1H NOESYunlabelled_d2oisotropicd2o_298K
2D 1H-1H TOCSYunlabelled_d2oisotropicd2o_298K
2D 1H-1H NOESYdeuterated_d2oisotropicd2o_298K
2D 1H-13C HSQC aliphaticlabelled_h2oisotropich2o_298K
2D 1H-13C HSQC aliphaticlabelled_h2o_phageanisotropich2o_298K
2D 1H-15N HSQClabelled_h2oisotropich2o_278K
2D 1H-13C HSQC aromaticlabelled_h2oisotropich2o_298K
2D 1H-13C HSQC aromaticlabelled_h2o_phageanisotropich2o_298K
2D 1H-13C HSQC aliphaticlabelled_d2oisotropicd2o_298K
2D 1H-13C HSQC aromaticlabelled_d2oisotropicd2o_298K
2D 1H-1H NOESYunlabelled_h2oisotropich2o_278K
2D 1H-1H NOESYunlabelled_h2oisotropich2o_278K
2D 1H-1H NOESYunlabelled_h2oisotropich2o_293K
2D JNN HNN COSYlabelled_h2oisotropich2o_278K
1D-31Punlabelled_d2oisotropicd2o_298K
F1,2 X-filtered 1H-1H NOESYlabelled_h2oisotropich2o_298K
F1,2 X-filtered 1H-1H TOCSYlabelled_h2oisotropich2o_298K

Software:

SPARKY v3.1, Goddard - chemical shift assignment, data analysis, peak picking

TOPSPIN v1.3, 2.0, 2.1, Bruker Biospin - collection, processing

DYANA v1.5, Guntert, Braun and Wuthrich - data analysis

CNSSOLVE v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH v2.24, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 500 MHz