BMRB Entry 5345

Assignment of lac repressor headpiece complexed of its natural operator   PubMed: 12065400
Deposition date:
Original release date:
Kalodimos, C.; Bonvin, A.; Salinas, R.; Wechselberger, R.; Boelens, R.; Kaptein, R.


Assembly members:

Assembly members:
lactose repressor-operator, polymer, 62 residues, 7000 Da.
lactose repressor-operator DNA, polymer, 23 residues, Formula weight is not available
lactose repressor-operator DNA, polymer, 23 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Eubacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: recombinant technology

Experimental source:

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Eubacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):

Entity Sequences (FASTA):
lactose repressor-operator DNA: GAATTGTGAGCGGATAACAA TTT
lactose repressor-operator DNA: AAATTGTTATCCGCTCACAA TTC

Data typeCount
13C chemical shifts458
1H chemical shifts1207
15N chemical shifts138

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all


Entity Assembly IDEntity NameEntity ID
1Lactose operon repressor, chain A1
2Lactose operon repressor, chain B1
3LAC-DNA, chain A2
4LAC-DNA, chain B3


Entity 1, Lactose operon repressor, chain A 62 residues - 7000 Da.


Entity 2, LAC-DNA, chain A 23 residues - Formula weight is not available


Entity 3, LAC-DNA, chain B 23 residues - Formula weight is not available



sample_1: lactose repressor-operator, [U-15N; U-13C], 4 mM; lactose repressor-operator DNA 2 mM; lactose repressor-operator DNA 2 mM; KPi 10 mM; KCl 20 mM; D2O 10%; H2O 90%

sample_cond_1: pH: 6.0 na; temperature: 315 K; ionic strength: 30 mM; pressure: 1 atm


NameSampleSample stateSample conditions
3D 13C-separated NOESYsample_1not availablesample_cond_1
3D 15N-separated NOESYsample_1not availablesample_cond_1
2D NOESYsample_1not availablesample_cond_1


XWINNMR v3.1 - collection

NMRPipe v1.0 - processing

NMRView v5.0.4 - data analysis

CNS v1.1 - structure solution, refinement

NMR spectrometers:

  • Bruker DRX 600 MHz
  • Bruker DRX 750 MHz

Related Database Links:

BMRB 1066 127 1494 1552 32 4813 5791 661 736 848 849 96
DBJ BAB20667 BAB33821 BAD00175 BAD20286 BAD20288
EMBL CAA07594 CAA07597 CAA11118 CAA11119 CAA11120
GB AAA24052 AAA56744 AAA56768 AAA57088 AAA57091
REF NP_286086 NP_414879 WP_000718174 WP_000805876 WP_000805884
SP P03023
AlphaFold P03023

Download HSQC peak lists in one of the following formats:
CSV: Backbone or all simulated peaks
SPARKY: Backbone or all simulated peaks