Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5345

Title: Assignment of lac repressor headpiece complexed of its natural operator   PubMed: 12065400

Deposition date: 2002-04-19 Original release date: 2002-06-07

Authors: Kalodimos, C.; Bonvin, A.; Salinas, R.; Wechselberger, R.; Boelens, R.; Kaptein, R.


Assembly members:
lactose repressor-operator, polymer, 62 residues, 7000 Da.
lactose repressor-operator DNA, polymer, 23 residues, Formula weight is not available
lactose repressor-operator DNA, polymer, 23 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: 562   Superkingdom: not available   Kingdom: Escherichia   Genus/species: coli not available

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
lactose repressor-operator DNA: GAATTGTGAGCGGATAACAA TTT
lactose repressor-operator DNA: AAATTGTTATCCGCTCACAA TTC

Data typeCount
13C chemical shifts458
1H chemical shifts1207
15N chemical shifts138

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all


Entity Assembly IDEntity NameEntity ID
1Lactose operon repressor, chain A1
2Lactose operon repressor, chain B1
3LAC-DNA, chain A2
4LAC-DNA, chain B3


Entity 1, Lactose operon repressor, chain A 62 residues - 7000 Da.


Entity 2, LAC-DNA, chain A 23 residues - Formula weight is not available


Entity 3, LAC-DNA, chain B 23 residues - Formula weight is not available



sample_1: lactose repressor-operator' '[U-15N; U-13C]; .; .; .; .; .; .

sample_cond_1: pH: 6.0 na; temperature: 315 K; ionic strength: 30 mM; pressure: 1 atm


NameSampleSample stateSample conditions
3D 13C-separated NOESYsample_1not availablesample_cond_1
3D 15N-separated NOESYsample_1not availablesample_cond_1
2D NOESYsample_1not availablesample_cond_1


XWINNMR v3.1 - collection

NMRPipe v1.0 - processing

NMRView v5.0.4 - data analysis

CNS v1.1 - structure solution, refinement

NMR spectrometers:

  • Bruker DRX 600 MHz
  • Bruker DRX 750 MHz

Related Database Links:

BMRB 1066 127 1494 1552 32 4813 5791 661 736 848 849 96
DBJ BAB20667 BAB33821 BAD00175 BAD20286 BAD20288
EMBL CAA07594 CAA07597 CAA11118 CAA11119 CAA11120
GB AAA24052 AAA56744 AAA56768 AAA57088 AAA57091
REF NP_286086 NP_414879 WP_000718174 WP_000805876 WP_000805884
SP P03023

Download simulated HSQC data in one of the following formats:
CSV: Backbone or all simulated shifts
SPARKY: Backbone or all simulated shifts