Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51037
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wagner, Nicole; Foster, Mark. "Nearest-neighbor effects modulate loxP spacer DNA chemical shifts and guide oligonucleotide design for nuclear magnetic resonance studies" Biochemistry 61, 67-76 (2022).
PubMed: 34985267
Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available
entity_2, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available
Experimental source: Production method: obtained from a vendor
Entity Sequences (FASTA):
entity_1: GCGTATAATGTATGCTATAC
GG
entity_2: CCGTATAGCATACATTATAC
GC
| Data type | Count |
| 1H chemical shifts | 33 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | A | 1 |
| 2 | B | 2 |
Entity 1, A 22 residues - Formula weight is not available
| 1 | DG | DC | DG | DT | DA | DT | DA | DA | DT | DG | ||||
| 2 | DT | DA | DT | DG | DC | DT | DA | DT | DA | DC | ||||
| 3 | DG | DG |
Entity 2, B 22 residues - Formula weight is not available
| 1 | DC | DC | DG | DT | DA | DT | DA | DG | DC | DA | ||||
| 2 | DT | DA | DC | DA | DT | DT | DA | DT | DA | DC | ||||
| 3 | DG | DC |
sample_1: loxP spacer 22-mer 590 uM; sodium chloride 100 mM; TRIS, [U-2H], 10 mM; DSS 50 uM; sodium azide 0.02%; D2O 10%
sample_conditions_1: ionic strength: 0.1 M; pH: 7.0; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D 1H | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC anomeric | sample_1 | isotropic | sample_conditions_1 |
NMRFx Processor - processing
TOPSPIN - collection
NMRViewJ - chemical shift assignment, data analysis, peak picking