Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17222
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Nick, Harry; Arndt, Kim; Boschelli, Frank; Jarema, Mary Ann; Lillis, Marcella; Sadler, John; Caruthers, Marvin; Lu, Ponzy. "lac repressor-lac operator interaction: NMR observations" Proc. Natl. Acad. Sci. U.S.A. 79, 218-222 (1982).
PubMed: 7043455
Assembly members:
operator, polymer, 73 residues, Formula weight is not available
repressor, polymer, 7 residues, Formula weight is not available
Natural source: Common Name: cattle Taxonomy ID: 9913 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Bos taurus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pOE101
Entity Sequences (FASTA):
operator: CCACATGTGGAATTGTGAGC
GGATAACAATTTGTGGGGTG
TACACCTTAACACTCGCCTA
TTGTTAAACACC
repressor: MXXXHYL
| Data type | Count |
| binding constants | 9 |
| kinetic rates | 1 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | operator | 1 |
| 2 | repressor | 2 |
Entity 1, operator 73 residues - Formula weight is not available
| 1 | DC | DC | DA | DC | DA | DT | DG | DT | DG | DG | ||||
| 2 | DA | DA | DT | DT | DG | DT | DG | DA | DG | DC | ||||
| 3 | DG | DG | DA | DT | DA | DA | DC | DA | DA | DT | ||||
| 4 | DT | DT | DG | DT | DG | DG | DG | DG | DT | DG | ||||
| 5 | DT | DA | DC | DA | DC | DC | DT | DT | DA | DA | ||||
| 6 | DC | DA | DC | DT | DC | DG | DC | DC | DT | DA | ||||
| 7 | DT | DT | DG | DT | DT | DA | DA | DA | DC | DA | ||||
| 8 | DC | DC |
Entity 2, repressor 7 residues - Formula weight is not available
X=YOF
| 1 | MET | YOF | YOF | YOF | HIS | TYR | LEU |
sample_1: operator0 0.0000375 mM; repressor 0.00003 mM; Tris 0.25 M; potassium chloride 0.2 M; EDTA 1 mM; dithiothreitol 1 mM; H2O 75%; D2O 25%
sample_2: operator0 0.0000375 mM; repressor 0.00003 mM; Tris 0.25 M; potassium chloride 0.5 M; EDTA 1 mM; dithiothreitol 1 mM; H2O 75%; D2O 25%
sample_3: operator0 0.0000375 mM; repressor 0.00003 mM; Tris 0.25 M; potassium chloride 0.5 M; EDTA 1 mM; dithiothreitol 1 mM; iPrSGal 0.0012 mM; H2O 75%; D2O 25%
sample_conditions_1: pH: 7.4; pressure: 1 atm; temperature: 295 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 19F NMR | sample_1 | isotropic | sample_conditions_1 |
| 19F NMR | sample_2 | isotropic | sample_conditions_1 |
| 19F NMR | sample_3 | isotropic | sample_conditions_1 |
software, na - na