Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25867
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Au, Hilda; Cornilescu, Gabriel; Mouzakis, Kathryn; Ren, Qian; Burke, Jordan; Lee, Seonghoon; Butcher, Samuel; Jan, Eric. "Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection" Proc. Natl. Acad. Sci. U.S.A. 112, E6446-E6455 (2015).
PubMed: 26554019
Assembly members:
RNA_(70-MER), polymer, 70 residues, 22565.592 Da.
Natural source: Common Name: honey bee Taxonomy ID: 7460 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Apis mellifera
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free Vector: n/a
Entity Sequences (FASTA):
RNA_(70-MER): GGAACAGCUGUACUGGGCAG
UUACAGCAGUCGUAUGGUAA
CACAUGCGGCGUUCCGAAAU
ACCAUGCCUG
| Data type | Count |
| 15N chemical shifts | 29 |
| 1H chemical shifts | 29 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (70-MER) | 1 |
Entity 1, RNA (70-MER) 70 residues - 22565.592 Da.
| 1 | G | G | A | A | C | A | G | C | U | G | |
| 2 | U | A | C | U | G | G | G | C | A | G | |
| 3 | U | U | A | C | A | G | C | A | G | U | |
| 4 | C | G | U | A | U | G | G | U | A | A | |
| 5 | C | A | C | A | U | G | C | G | G | C | |
| 6 | G | U | U | C | C | G | A | A | A | U | |
| 7 | A | C | C | A | U | G | C | C | U | G |
sample_1: RNA (70-MER), [U-13C; U-15N]-Gua, 0.53 0.70 mM; potassium phosphate 10 mM; potassium chloride 200 mM; Ethylenediaminetetraacetic acid 50 uM; H2O 90%; D2O 10%
sample_2: RNA (70-MER), [U-13C; U-15N]-Gua, 0.53 0.70 mM; Pf1 phage 12.5 mg/ml; potassium phosphate 10 mM; potassium chloride 200 mM; Ethylenediaminetetraacetic acid 50 uM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 0.225 M; pH: 6.3; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N TROSY-HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY-HMQC | sample_2 | anisotropic | sample_conditions_1 |
TOPSPIN, Bruker Biospin - collection
SPARKY, Goddard - chemical shift assignment
MC-SIM v4.2.2, Parisien, Major - structure solution
NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis, peak picking
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement