BMRB Entry 34467
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34467
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Baifan, W.; Tjasa, F.; Janez, P.; Primoz, S.. "Pre-folded structures govern folding pathways of human telomeric G-quadruplexes" Nucleic Acids Res. 48, 2189-2197 (2020).
PubMed: 31950178
Assembly members:
entity_1, polymer, 23 residues, 7287.690 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TAGGGTTAGGGTTAGGGTTA
GGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 50 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 23 residues - 7287.690 Da.
| 1 | DT | DA | DG | DG | DG | DT | DT | DA | DG | DG | ||||
| 2 | DG | DT | DT | DA | DG | DG | DG | DT | DT | DA | ||||
| 3 | DG | DG | DG |
Samples:
sample_1: GCN, [8% 13C; 8% 15N], 1 mM
sample_2: GCN 1 mM
sample_conditions_1: ionic strength: 0 mM; pH: 5; pressure: 1 atm; temperature: 278 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 1D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D NOESY | sample_2 | isotropic | sample_conditions_1 |
Software:
VNMR, Varian - processing
Sparky, Goddard - chemical shift assignment, peak picking
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
NMR spectrometers:
- Agilent Agilent Agilent Technologies DD2 600 MHz NMR spectrometer 600 MHz