Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17921
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vander Muelen, Kirk; Davis, Jared; Clos, Lawrence; Butcher, Samuel. "Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant." The BMRB entry is the only known published source for the data..
Assembly members:
TECTO47, polymer, 47 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
TECTO47: GGAGGAUAUGGAAGAACCGG
GGUGACUUGGUUCUUCCUAA
GUCCUCC
| Data type | Count |
| 15N chemical shifts | 22 |
| 1H chemical shifts | 32 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | GAAA tetraloop monomer | 1 |
Entity 1, GAAA tetraloop monomer 47 residues - Formula weight is not available
| 1 | G | G | A | G | G | A | U | A | U | G | ||||
| 2 | G | A | A | G | A | A | C | C | G | G | ||||
| 3 | G | G | U | G | A | C | U | U | G | G | ||||
| 4 | U | U | C | U | U | C | C | U | A | A | ||||
| 5 | G | U | C | C | U | C | C |
sample_unlabeled: TECTO47 1 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%
sample_labeled: TECTO47, [U-100% 13C; U-100% 15N], 1 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_labeled | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_unlabeled | isotropic | sample_conditions_1 |
xwinnmr v3.5, Bruker Biospin - collection, processing
SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking