Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31106
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Geng, A.; Ganser, L.; Roy, R.; Shi, H.; Pratihar, S.; Case, D.; Al-Hashimi, H.. "An RNA excited conformational state at atomic resolution
" Nat. Commun. 14, 8432-8432 (2023).
PubMed: 38114465
Assembly members:
entity_1, polymer, 31 residues, 9918.902 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCAGAUCUGAGCCUUCGGG
AGCUCUCUGCC
| Data type | Count |
| 13C chemical shifts | 87 |
| 15N chemical shifts | 12 |
| 1H chemical shifts | 100 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 31 residues - 9918.902 Da.
| 1 | G | G | C | A | G | A | U | C | U | G | ||||
| 2 | A | G | C | C | U | U | C | G | G | G | ||||
| 3 | A | G | C | U | C | U | C | U | G | C | ||||
| 4 | C |
sample_1: UUCGES2_TAR, [U-100% 13C; U-100% 15N], 1 mM
sample_conditions_1: ionic strength: 25 mM; pH: 6.4; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC sugar | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC sugar | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
Rosetta, Honglue Shi - structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement