Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6975
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Dai, Jixun; Dexheimer, T.; Chen, Ding; Carver, M.; Ambrus, A.; Jones, Roger; Yang, Danzhou. "An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands
formed in the human BCL-2 promoter region in solution" J. Am. Chem. Soc. 128, 1096-1098 (2006).
Assembly members:
Bcl2 middle G4 oligonucleotides, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Bcl2 middle G4 oligonucleotides: GGGCGCGGGAGGAATTGGGC
GGG
Data type | Count |
1H chemical shifts | 199 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | Bcl2MidG4Pu23-G15T_G16T | 1 |
Entity 1, Bcl2MidG4Pu23-G15T_G16T 23 residues - Formula weight is not available
1 | DG | DG | DG | DC | DG | DC | DG | DG | DG | DA | ||||
2 | DG | DG | DA | DA | DT | DT | DG | DG | DG | DC | ||||
3 | DG | DG | DG |
sample_1: Bcl2 middle G4 oligonucleotides 1.5 mM
conditions_1: pH: 7.0; temperature: 298 K
Name | Sample | Sample state | Sample conditions |
---|
No software information available