Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6077
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Du, Z.; Ulyanov, N.; Yu, J.; Andino, R.; James, T.. "NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus
Internal Ribosome Entry Site: A Single C-to-U Substitution Drastically Changes
the Shape and Flexibility of RNA" Biochemistry 43, 5757-5771 (2004).
PubMed: 15134450
Assembly members:
RNA FRAGMENT OF DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES, polymer, 34 residues, Formula weight is not available
Natural source: Common Name: Enterovirus poliovirus Taxonomy ID: 138953 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus poliovirus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA FRAGMENT OF DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES: GGAGGACAUUCCUCACGGGU
GACCGUGGUCCUCC
| Data type | Count |
| 13C chemical shifts | 89 |
| 1H chemical shifts | 407 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | stem-loop RNA, U10 | 1 |
Entity 1, stem-loop RNA, U10
sample_1: RNA FRAGMENT OF DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES1.0 2.0 mM; NaCl 25 mM; sodium phosphate buffer 25 mM; H2O 90%; D2O 10%
sample_2: RNA FRAGMENT OF DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES1.0 2.0 mM; NaCl 25 mM; sodium phosphate buffer 25 mM; D2O 100%
sample_3: RNA FRAGMENT OF DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES, [U-13C; U-15N]-A, U, 1.0 2.0 mM; NaCl 25 mM; sodium phosphate buffer 25 mM; D2O 100%
sample_4: RNA FRAGMENT OF DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES, [U-13C; U-15N]-A, U, 1.0 2.0 mM; NaCl 25 mM; sodium phosphate buffer 25 mM; D2O 100%; C12E6/N-HEXANOL MIXTURE (MOLAR RATIO 0.64) 5%
sample_cond_1: ionic strength: 50 mM; pH*: 6.5; pressure: 1 atm; temperature: 298 K
sample_cond_2: ionic strength: 50 mM; pH*: 6.5; pressure: 1 atm; temperature: 278 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | not available |
| DQF-COSY | not available | not available | not available |
| 1H-13C CONSTANT TIME HSQC | not available | not available | not available |
VNMR v6.1 - collection
NMRPipe v2.1 - processing
MARDIGRAS v3.2 - iterative matrix relaxation
DYANA v1.5 - refinement
AMBER v7 - refinement