Click here to enlarge.
PDB ID: 6hag
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27452
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Weickhmann, A Katharina; Keller, Heiko; Duchardt-Ferner, Elke; Strebitzer, Elisabeth; Juen, Michael; Kremser, Johannes; Wurm, Jan Philip; Kreutz, Christoph; Wohnert, Jens. "NMR resonance assignments for the SAM/SAH-binding riboswitch RNA bound to S-adenosylhomocysteine" Biomol. NMR Assign. 12, 329-334 (2018).
PubMed: 30051308
Assembly members:
env9b, polymer, 43 residues, Formula weight is not available
S-ADENOSYL-L-HOMOCYSTEINE, non-polymer, 384.411 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pSP64
Entity Sequences (FASTA):
env9b: GUCACAACGGCUUCCUGACG
UGGCAGAUUGAAUUAUUGGA
GCA
Data type | Count |
13C chemical shifts | 313 |
15N chemical shifts | 126 |
1H chemical shifts | 318 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | env9b | 1 |
2 | SAH | 2 |
Entity 1, env9b 43 residues - Formula weight is not available
1 | G | U | C | A | C | A | A | C | G | G | ||||
2 | C | U | U | C | C | U | G | A | C | G | ||||
3 | U | G | G | C | A | G | A | U | U | G | ||||
4 | A | A | U | U | A | U | U | G | G | A | ||||
5 | G | C | A |
Entity 2, SAH - C14 H20 N6 O5 S - 384.411 Da.
1 | SAH |