BMRB Entry 28094

Title:
Solution NMR structure of 5'UTR of Stem loop B in DENV4   PubMed: 32807496
Deposition date:
2020-03-06
Original release date:
2020-08-18
Authors:
Sharma, Shrikant; Varani, Gabriele
Citation:

Citation: Sharma, Shrikant; Varani, Gabriele. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication"  Biochem. Biophys. Res. Commun. 531, 522-527 (2020).

Assembly members:

Assembly members:
DENV4, polymer, 41 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: Flavivirus   Taxonomy ID: 11051   Superkingdom: Viruses   Kingdom: not available   Genus/species: Flavivirus not available

Experimental source:   Production method: reverse transcriptase   Host organism: Dengue virus   Vector: Ades

Experimental source:

Natural source:   Common Name: Flavivirus   Taxonomy ID: 11051   Superkingdom: Viruses   Kingdom: not available   Genus/species: Flavivirus not available

Experimental source:   Production method: reverse transcriptase   Host organism: Dengue virus   Vector: Ades

Entity Sequences (FASTA):

Entity Sequences (FASTA):
DENV4: GGUUUGUUUGAAUAGAGAGC AGAUCUCUGGAAAAAUGAAC C

Data sets:
Data typeCount
13C chemical shifts265
15N chemical shifts18
1H chemical shifts327

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
15_prime_UTR1

Entities:

Entity 1, 5_prime_UTR 41 residues - Formula weight is not available

1   GGUUUGUUUG
2   AAUAGAGAGC
3   AGAUCUCUGG
4   AAAAAUGAAC
5   C

Samples:

sample_1: DENV4, [U-99% 13C; U-99% 15N], 0.75 mM; sodium phosphate 20 mM

sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 800 MHz