Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR28094
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sharma, Shrikant; Varani, Gabriele. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication" Biochem. Biophys. Res. Commun. 531, 522-527 (2020).
PubMed: 32807496
Assembly members:
DENV4, polymer, 41 residues, Formula weight is not available
Natural source: Common Name: Flavivirus Taxonomy ID: 11051 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus not available
Experimental source: Production method: reverse transcriptase Host organism: Dengue virus Vector: Ades
Entity Sequences (FASTA):
DENV4: GGUUUGUUUGAAUAGAGAGC
AGAUCUCUGGAAAAAUGAAC
C
| Data type | Count |
| 13C chemical shifts | 265 |
| 15N chemical shifts | 18 |
| 1H chemical shifts | 327 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 5_prime_UTR | 1 |
Entity 1, 5_prime_UTR 41 residues - Formula weight is not available
| 1 | G | G | U | U | U | G | U | U | U | G | ||||
| 2 | A | A | U | A | G | A | G | A | G | C | ||||
| 3 | A | G | A | U | C | U | C | U | G | G | ||||
| 4 | A | A | A | A | A | U | G | A | A | C | ||||
| 5 | C |
sample_1: DENV4, [U-99% 13C; U-99% 15N], 0.75 mM; sodium phosphate 20 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 293 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
SPARKY, Goddard - chemical shift assignment