BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 28094

Title: Solution NMR structure of 5'UTR of Stem loop B in DENV4   PubMed: 32807496

Deposition date: 2020-03-06 Original release date: 2020-08-18

Authors: Sharma, Shrikant; Varani, Gabriele

Citation: Sharma, Shrikant; Varani, Gabriele. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication"  Biochem. Biophys. Res. Commun. ., .-. (2020).

Assembly members:
DENV4, polymer, 41 residues, Formula weight is not available

Natural source:   Common Name: Flavivirus   Taxonomy ID: 11051   Superkingdom: Viruses   Kingdom: not available   Genus/species: Flavivirus not available

Experimental source:   Production method: reverse transcriptase' 'Dengue virus

Entity Sequences (FASTA):
DENV4: GGUUUGUUUGAAUAGAGAGC AGAUCUCUGGAAAAAUGAAC C

Data sets:
Data typeCount
13C chemical shifts265
15N chemical shifts18
1H chemical shifts327

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
15_prime_UTR1

Entities:

Entity 1, 5_prime_UTR 41 residues - Formula weight is not available

1   GGUUUGUUUG
2   AAUAGAGAGC
3   AGAUCUCUGG
4   AAAAAUGAAC
5   C

Samples:

sample_1: DENV4, [U-99% 13C; U-99% 15N], 0.75 mM; sodium phosphate' 'natural abundance

sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 800 MHz