Click here to enlarge.
PDB ID: 2rrc
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR11176
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Nomura, Yusuke; Fukunaga, Jun-ichi; Tanaka, Yoichiro; Fujiwara, Kazuya; Chiba, Manabu; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko. "A novel high affinity RNA motif that mimics DNA in AML1 Runt domain binding" .
Assembly members:
AML22, polymer, 22 residues, 7032 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
AML22: GGACCCACCACGGCGAGGUC
CA
Data type | Count |
1H chemical shifts | 105 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | AML22 | 1 |
Entity 1, AML22 22 residues - 7032 Da.
1 | G | G | A | C | C | C | A | C | C | A | ||||
2 | C | G | G | C | G | A | G | G | U | C | ||||
3 | C | A |