Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR11438
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Furuita, Kyoko; Murata, Shunpei; Jee, JunGoo; Ichikawa, Satoshi; Matsuda, Akira; Kojima, Chojiro. "Structural Feature of Bent DNA Recognized by HMGB1" J. Am. Chem. Soc. 133, 5788-5790 (2011).
PubMed: 21443191
Assembly members:
Ethylene-DNA, polymer, 28 residues, 111.103 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Ethylene-DNA: CCTTCATTACATCCGGATGT
AATGAAGG
| Data type | Count |
| 1H chemical shifts | 211 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Ethylene-DNA | 1 |
Entity 1, Ethylene-DNA 28 residues - 111.103 Da.
| 1 | DC | DC | DT | DT | DC | DA | DT | DT | DA | DC | ||||
| 2 | DA | DT | DC | DC | DG | DG | DA | DT | DG | DT | ||||
| 3 | DA | DA | DT | DG | DA | DA | DG | DG |
sample_1: Ethylene-DNA 0.7 mM; sodium phosphate 50 mM; sodium chloride 100 mM; H2O 90%; D2O 10%
sample_2: Ethylene-DNA 0.7 mM; sodium phosphate 50 mM; sodium chloride 100 mM; D2O 100%
sample_conditions_1: pH: 6.8; temperature: 283 K
sample_conditions_2: pH: 6.8; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_2 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_2 |
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY, Goddard - chemical shift assignment
CNS v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution
MARDIGRAS, Brandan, A. Borgias, Paul D. Thomas, He Liu and Anil Kumar - structure solution