Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34035
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Galer, P.; Wang, B.; Sket, P.; Plavec, J.. "Reversible pH Switch of Two-Quartet G-Quadruplexes Formed by Human Telomere" Angew. Chem. Int. Ed. Engl. 55, 1993-1997 (2016).
PubMed: 26836334
Assembly members:
DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3'), polymer, 22 residues, 6958.484 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3'): TAGGGTTAGGGTTAGGGTTA
GG
Data type | Count |
1H chemical shifts | 172 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 22 residues - 6958.484 Da.
1 | DT | DA | DG | DG | DG | DT | DT | DA | DG | DG | ||||
2 | DG | DT | DT | DA | DG | DG | DG | DT | DT | DA | ||||
3 | DG | DG |
sample_2: DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3') 1 mM; potassium chloride 70 mM
sample_3: DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3') 1 mM; potassium chloride 70 mM
sample_1: DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*G)-3'), 8% 13C, 8% 15N, 1 mM; potassium chloride 70 mM
sample_conditions_1: ionic strength: 70 mM; pH: 5.0; pressure: 1 atm; temperature: 278 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
1D 1H-15N HSQC | sample_1 | anisotropic | sample_conditions_1 |
2D 1H-15N HSQC NH2 only | sample_1 | anisotropic | sample_conditions_1 |
2D 1H-13C HSQC aromatic | sample_1 | anisotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_2 | anisotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_3 | anisotropic | sample_conditions_1 |
2D NOESY | sample_3 | anisotropic | sample_conditions_1 |
2D DQF-COSY | sample_3 | anisotropic | sample_conditions_1 |
2D ROESY | sample_2 | anisotropic | sample_conditions_1 |
2D NOESY | sample_2 | anisotropic | sample_conditions_1 |
AMBER v14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - chemical shift calculation, refinement
SPARKY, Goddard - peak picking
VNMR, Varian - chemical shift assignment, collection, processing