BMRB Entry 50343

Title:
Assignment of base 1H and 15N chemical shifts for 3_SL2   PubMed: 33167030
Deposition date:
2020-06-23
Original release date:
2020-07-10
Authors:
Schwalbe, Harald; Richter, Christian
Citation:

Citation: Wacker, Anna; Weigand, Julia; Akabayov, Sabine; Altincekic, Nadide; Kaur Bains, Jasleen; Banijamali, Elnaz; Binas, Oliver; Castillo-Martinez, Jesus; Cetiner, Erhan; Ceylan, Betul; Chiu, Liang-Yuan; Davila-Calderon, Jesse; De Jesus, Vanessa; Dhamotharan, Karthikeyan; Duchardt-Ferner, Elke; Ferner, Jan; Frydman, Lucio; Furtig, Boris; Gallego, Jose; Grun, J. Tassilo; Hacker, Carolin; Haddad, Christina; Hahnke, Martin; Hengesbach, Martin; Hiller, Fabian; Hohmann, Katharina; Hymon, Daniel; Jonker, Henry; Keller, Heiko; Knezic, Bozana; Landgraf, Tom; Lohr, Frank; Luo, Luke; Mertinkus, Klara; Muhs, Christina; Novakovic, Mihajlo; Oxenfarth, Andreas; Palomino-Schatzlein, Martina; Petzold, Katja; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Riad, Magdalena; Richter, Christian; Saxena, Krishna; Schamber, Tatjana; Scherf, Tali; Schlagnitweit, Judith; Schlundt, Andreas; Schnieders, Robbin; Schwalbe, Harald; Simba-Lahuasi, Alvaro; Sreeramulu, Sridhar; Stirnal, Elke; Sudakov, Alexey; Tants, Jan-Niklas; Tolbert, Blanton; Vogele, Jenny; Weiss, Lena; Wirmer-Bartoschek, Julia; Wirtz Martin, Maria; Wohnert, Jens; Zetzsche, Heidi. "Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy"  Nucleic Acids Res. 48, 12415-12435 (2020).

Assembly members:

Assembly members:
entity_1, polymer, 31 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: SARS-CoV-2   Taxonomy ID: 2697049   Superkingdom: Viruses   Kingdom: not available   Genus/species: Betacoronavirus HCoV-SARS

Experimental source:   Production method: transcription   Host organism: in vitro

Experimental source:

Natural source:   Common Name: SARS-CoV-2   Taxonomy ID: 2697049   Superkingdom: Viruses   Kingdom: not available   Genus/species: Betacoronavirus HCoV-SARS

Experimental source:   Production method: transcription   Host organism: in vitro

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGAACUACAUAGCACAAGUA GAUGUAGUUCC

Data sets:
Data typeCount
13C chemical shifts18
15N chemical shifts27
1H chemical shifts49

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
13_SL21

Entities:

Entity 1, 3_SL2 31 residues - Formula weight is not available

1   GGAACUACAU
2   AGCACAAGUA
3   GAUGUAGUUC
4   C

Samples:

sample_1: 3_SL2, [U-15N], 150 uM

sample_2: 3_SL2, [U-15N], 350 uM; potassium phosphate 25 mM; KCl 50 mM

sample_conditions_1: ionic strength: 0 mM; pH: 7; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
1D 1Hsample_2isotropicsample_conditions_2
HMT-NOESYsample_1isotropicsample_conditions_1
NOESY[15N]CPMGsample_1isotropicsample_conditions_1
HSQC[15N]-2Jsample_1isotropicsample_conditions_1
1H-JR[15N]sample_1isotropicsample_conditions_1
HSQC[15N]-Aminosample_1isotropicsample_conditions_1
NOESY[15N]-Iminosample_1isotropicsample_conditions_1
NOESY[15N]-Iminosample_1isotropicsample_conditions_1
TROSY[15N]sample_1isotropicsample_conditions_1

Software:

LOGS v2.2 - collection

SPARKY v3.114 - chemical shift assignment, peak picking

TOPSPIN v3.6.2 - collection

TOPSPIN v4.0.8 - collection

NMR spectrometers:

  • Bruker Bruker Avance III HD 600 MHz 600 MHz
  • Bruker Bruker Avance neo 600 MHz 600 MHz