Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR28113
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Sheng; Refaei, Maryanne; Liu, Shuohui; Decker, Aaron; Hinerman, Jennifer; Herr, Andrew; Howell, Mike; Musier-Forsyth, Karin; Tsang, Pearl. "Hairpin RNA-induced conformational change of a eukaryotic-specific lysyl-tRNA synthetase extension and role of adjacent anticodon-binding domain
" J. Biol. Chem. 295, 12071-12085 (2020).
PubMed: 32611767
Assembly members:
tRNAlys_Acceptor_stem, polymer, 35 residues, 11225.8 Da.
revmodN_protein, polymer, 76 residues, 8311.3 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pet30a
Entity Sequences (FASTA):
tRNAlys_Acceptor_stem: GCCCGGACAGGGUUCAAGUC
CCUGUUCGGGCGCCA
revmodN_protein: MAAVQAAEVKVDGSEPKLSK
NELKRRLKAEKKVAEKEAKQ
KELSEKQLSQATAAATNHTT
DNGVLPETGGHHHHHH
| Data type | Count |
| 13C chemical shifts | 198 |
| 15N chemical shifts | 68 |
| 1H chemical shifts | 68 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Lysyl tRNA acceptor stem | 1 |
| 2 | revmodN | 2 |
Entity 1, Lysyl tRNA acceptor stem 35 residues - 11225.8 Da.
This is the acceptor stem loop of human Lysyl tRNA isoacceptor 3
| 1 | G | C | C | C | G | G | A | C | A | G | ||||
| 2 | G | G | U | U | C | A | A | G | U | C | ||||
| 3 | C | C | U | G | U | U | C | G | G | G | ||||
| 4 | C | G | C | C | A |
Entity 2, revmodN 76 residues - 8311.3 Da.
Residues 70-76 are appended to this domain for enzyme ligation
| 1 | MET | ALA | ALA | VAL | GLN | ALA | ALA | GLU | VAL | LYS | ||||
| 2 | VAL | ASP | GLY | SER | GLU | PRO | LYS | LEU | SER | LYS | ||||
| 3 | ASN | GLU | LEU | LYS | ARG | ARG | LEU | LYS | ALA | GLU | ||||
| 4 | LYS | LYS | VAL | ALA | GLU | LYS | GLU | ALA | LYS | GLN | ||||
| 5 | LYS | GLU | LEU | SER | GLU | LYS | GLN | LEU | SER | GLN | ||||
| 6 | ALA | THR | ALA | ALA | ALA | THR | ASN | HIS | THR | THR | ||||
| 7 | ASP | ASN | GLY | VAL | LEU | PRO | GLU | THR | GLY | GLY | ||||
| 8 | HIS | HIS | HIS | HIS | HIS | HIS |
sample_1: revmodN protein, [U-99% 13C; U-99% 15N], 200 ± 20 uM; sodium phosphate 20 ± .05 mM; sodium chloride 15 ± .05 mM; potassium chloride 35 ± .05 mM
sample_conditions_1: ionic strength: 0.07 M; pH: 6.0; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCA | sample_1 | isotropic | sample_conditions_1 |
| 3D HN(CO)CA | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCO | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
| 3D CBCA(CO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D H(CCO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks