Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30853
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sun, Y.; Varani, G.. "Structure of the Dengue Virus RNA Promoter
" RNA 28, 1210-1223 (2022).
PubMed: 35750488
Assembly members:
entity_1, polymer, 28 residues, 9016.454 Da.
Natural source: Common Name: Escherichia phage T7 Taxonomy ID: 10760 Superkingdom: Viruses Kingdom: not available Genus/species: Teseptimavirus Escherichia phage T7
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCCGACAAGAACAGUUUCG
AAUCGGCC
| Data type | Count |
| 1H chemical shifts | 119 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 28 residues - 9016.454 Da.
| 1 | G | G | C | C | G | A | C | A | A | G | ||||
| 2 | A | A | C | A | G | U | U | U | C | G | ||||
| 3 | A | A | U | C | G | G | C | C |
sample_1: Stem3 400 uM
sample_2: Stem3, [U-100% 13C; U-100% 15N], 400 uM
sample_3: Stem3, [U-100% 13C; U-100% 15N], 400 uM
sample_conditions_1: ionic strength: 40 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - processing
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
NMRFAM-SPARKY, NMRFAM-SPARKY - chemical shift assignment