BMRB Entry 17567

Title:
26 nt artificial stemloop TASL2   PubMed: 22252483
Deposition date:
2011-04-01
Original release date:
2012-01-24
Authors:
Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic
Citation:

Citation: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic H-T. "A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets."  J. Biomol. NMR 52, 179-190 (2012).

Assembly members:

Assembly members:
TASL2, polymer, 26 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: cell free synthesis   Host organism: none   Vector: not applicable

Experimental source:

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: cell free synthesis   Host organism: none   Vector: not applicable

Entity Sequences (FASTA):

Entity Sequences (FASTA):
TASL2: GGGAUUCAUGCUUCGGCAUG AAUCCC

Data sets:
Data typeCount
13C chemical shifts77
1H chemical shifts101

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1TASL21

Entities:

Entity 1, TASL2 26 residues - Formula weight is not available

1   GGGAUUCAUG
2   CUUCGGCAUG
3   AAUCCC

Samples:

sample_1: TASL2 2 mM; D2O 100%

sample_2: TASL2 2 mM; H2O 95%; D2O 5%

sample_conditions_1: pH: 7.4; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection, processing

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 900 MHz