BMRB Entry 6485
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6485
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Stefl, R.; Allain, F.. "A novel RNA pentaloop fold involved in targeting ADAR2" RNA 11, 592-597 (2005).
PubMed: 15840813
Assembly members:
GluR-B R/G stem-loop RNA, polymer, 27 residues, Formula weight is not available
Natural source: Common Name: 9606 Taxonomy ID: Human Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
GluR-B R/G stem-loop RNA: GGUAACAAUAUGCUAAAUGU
UGUUACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 183 |
| 1H chemical shifts | 221 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | GluR-B R/G RNA | 1 |
Entities:
Entity 1, GluR-B R/G RNA 27 residues - Formula weight is not available
| 1 | G | G | U | A | A | C | A | A | U | A | ||||
| 2 | U | G | C | U | A | A | A | U | G | U | ||||
| 3 | U | G | U | U | A | C | C |
Samples:
sample_1: GluR-B R/G stem-loop RNA, [U-13C; U-15N], 0.5 – 2 mM
condition_1: pH: 6; temperature: 303 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_1 | not available | condition_1 |
| 2D TOCSY | sample_1 | not available | condition_1 |
| 13C-HSQC | sample_1 | not available | condition_1 |
| 3D 13-separated NOESY | sample_1 | not available | condition_1 |
| and 3D HCCH-TOCSY | sample_1 | not available | condition_1 |
Software:
No software information available
NMR spectrometers:
- Bruker Avance 900 MHz
- Bruker Avance 600 MHz