BMRB Entry 17901

Name: Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5&#039; Stem-Loop 30-mer Construct.
Published: 2011-09-28

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17901

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct.

Deposition date:

2011-08-29

Original release date:

2011-09-28

Authors:

Butcher, Samuel; Clos, Lawrence

Citation:

Citation: Clos, Lawrence; Butcher, Samuel. "Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct." The BMRB entry is the only known published source for the data..

Assembly members:

Assembly members:
U6_FSL_G1-29, polymer, 30 residues, Formula weight is not available

Natural source:

Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae

Experimental source:

Experimental source: Production method: enzymatic semisynthesis Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):

Entity Sequences (FASTA):
U6_FSL_G1-29: GGUUCGCGAAGUAACCCUUC GUGGACAUUU

Data sets:

assigned_chemical_shifts
- assigned_chem_shift_list_1

Data type	Count
13C chemical shifts	17
15N chemical shifts	12
1H chemical shifts	36

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	U6 snRNA	1

Entities:

Entity 1, U6 snRNA 30 residues - Formula weight is not available

Residue 1 was included for transcription purposes and should not be counted when comparing to S. cerevisiae U6 snRNA sequence.

1	G	G	U	U	C	G	C	G	A	A
2	G	U	A	A	C	C	C	U	U	C
3	G	U	G	G	A	C	A	U	U	U

Samples:

sample_1: U6 FSL G1-29, [U-13C; U-15N], 1.5 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-15N HSQC	sample_1	isotropic	sample_conditions_1
2D 1H-13C HSQC aliphatic	sample_1	isotropic	sample_conditions_1
2D 1H-13C HSQC aromatic	sample_1	isotropic	sample_conditions_1
2D 1H-1H TOCSY	sample_1	isotropic	sample_conditions_1
2D 1H-1H NOESY	sample_1	isotropic	sample_conditions_1

Software:

xwinnmr v3.5, Bruker Biospin - collection, processing

SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking

NMR spectrometers:

Bruker Avance 750 MHz
Bruker DMX 600 MHz