Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4400
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: van Dongen, M.; Doreleijers, J.; van der Marel, G.; van Boom, J.; Hilbers, C.; Wijmenga, S.. "Structure and Mechanism of Formation of the H-y5 isomer of an intramolecular DNA
triple helix
" Nat. Struct. Biol. 6, 854-859 (1999).
Assembly members:
H-y5 Triple Helix, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemically_synthesized
Entity Sequences (FASTA):
H-y5 Triple Helix: TCTTCCTTTTCCTTCTCCCG
AGAAGGTTTT
| Data type | Count |
| 1H chemical shifts | 247 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | h-y5 | 1 |
Entity 1, h-y5 30 residues - Formula weight is not available
| 1 | DT | DC | DT | DT | DC | DC | DT | DT | DT | DT | |
| 2 | DC | DC | DT | DT | DC | DT | DC | DC | DC | DG | |
| 3 | DA | DG | DA | DA | DG | DG | DT | DT | DT | DT |
sample_1: H-y5 Triple Helix2.0 4.0 mM
sample_cond_1: ionic strength: 100 mM; pH*: 4.5; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| NOESY | sample_1 | not available | sample_cond_1 |
| PE-COSY | sample_1 | not available | sample_cond_1 |
| TOCSY | sample_1 | not available | sample_cond_1 |
| 31P-1H | sample_1 | not available | sample_cond_1 |
| TOCSY-NOESY | sample_1 | not available | sample_cond_1 |
XEASY - assignment book keeping and cross peak integration