BMRB Entry 50669

Title:
3_SL2
Deposition date:
2020-12-20
Original release date:
2022-02-01
Authors:
Schwalbe, Harald; Sreeramulu, Sridhar; Richter, Christian
Citation:

Citation: Sreeramulu, Sridhar; Richter, Christian; Berg, Hannes; Wirtz Martin, Maria; Ceylan, Betul; Matzel, Tobias; Adam, Jennifer; Altincekic, Nadide; Azzaoui, Kamal; Bains, Jasleen Kaur; Blommers, Marcel; Ferner, Jan; Furtig, Boris; Gobel, M.; Grun, J Tassilo; Hengesbach, Martin; Hohmann, Katharina; Hymon, Daniel; Knezic, Bozana; Martins, Jason; Mertinkus, Klara; Niesteruk, Anna; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Scheffer, Ute; Schlundt, Andreas; Schnieders, Robbin; Stirnal, Elke; Sudakov, Alexey; Troster, Alix; Vogele, Jennifer; Wacker, Anna; Weigand, Julia; Wirmer-Bartoschek, Julia; Wohnert, Jens; Schwalbe, Harald. "Exploring the druggability of conserved RNA regulatory elements in the SARS-CoV-2 genome "  Angew. Chem. Int. Ed. Engl. 60, 19191-19200 (2021).
PubMed: 34161644

Assembly members:

Assembly members:
entity_1, polymer, 31 residues, Formula weight is not available
entity_2, non-polymer, Formula weight is not available

Natural source:

Natural source:   Common Name: SARS-CoV-2   Taxonomy ID: 2697049   Superkingdom: Viruses   Kingdom: not available   Genus/species: Betacoronavirus HCoV-SARS

Experimental source:

Experimental source:   Production method: transcription   Host organism: in-vitro

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGAACUACAUAGCACAAGUA GAUGUAGUUCC

Data sets:
Data typeCount

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
13_SL21
2DSI-Poised Library (DSI-PL)2

Entities:

Entity 1, 3_SL2 31 residues - Formula weight is not available

1   GGAACUACAU
2   AGCACAAGUA
3   GAUGUAGUUC
4   C

Entity 2, DSI-Poised Library (DSI-PL) - Formula weight is not available

Samples:

sample_1: 3_SL2 10 uM; potassium phosphate 25 mM; KCl 50 mM; H2O 95%; DMSO, [U-100% 2H], 5%; Fragment 1 200 uM; Fragment 2 200 uM; Fragment 3 200 uM; Fragment 4 200 uM; Fragment 5 200 uM; Fragment 6 200 uM; Fragment 7 200 uM; Fragment 8 200 uM; Fragment 9 200 uM; Fragment 10 200 uM; Fragment 11 200 uM; Fragment 12 200 uM

sample_2: potassium phosphate 25 mM; KCl 50 mM; H2O 95%; DMSO, [U-100% 2H], 5%; Fragment 1 200 uM; Fragment 2 200 uM; Fragment 3 200 uM; Fragment 4 200 uM; Fragment 5 200 uM; Fragment 6 200 uM; Fragment 7 200 uM; Fragment 8 200 uM; Fragment 9 200 uM; Fragment 10 200 uM; Fragment 11 200 uM; Fragment 12 200 uM

sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
1D 1Hsample_1isotropicsample_conditions_1
1D 1H waterLOGSYsample_1isotropicsample_conditions_1
1H R2 CPMG 5mssample_1isotropicsample_conditions_1
1H R2 CPMG 100mssample_1isotropicsample_conditions_1
1D 1H refsample_2isotropicsample_conditions_1
1D 1H waterLOGSY refsample_2isotropicsample_conditions_1
1H R2 CPMG 5ms refsample_2isotropicsample_conditions_1
1H R2 CPMG 100ms refsample_2isotropicsample_conditions_1

Software:

LOGS v2.2 - collection

TOPSPIN v4.0.9 - collection, data analysis

NMR spectrometers:

  • Bruker Bruker Avance Neo 600 MHz