BMRB Entry DOI: doi:10.13018/BMR15786
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Van der Werf, Ramon; Girard, Frederic; Nelissen, Frank; Tessari, Marco; Wijmenga, Sybren. "1H, 13C and 15N NMR assignments of Duck HBV primer loop of the encapsidation signal epsilon" Biomol. NMR Assignments 2, 143-145 (2008).
PubMed: 19636890
Assembly members:
EDHBVwt, polymer, 37 residues, Formula weight is not available
Natural source: Common Name: Hepatitis B Virus Taxonomy ID: 10407 Superkingdom: Viruses Kingdom: not available Genus/species: Orthohepadnavirus Hepatitis B Virus
Experimental source: Production method: enzymatic semisynthesis Host organism: Escherichia coli
Entity Sequences (FASTA):
EDHBVwt: GGACGAUCUUUACGUCCGCU
UCGGCGGACUGUCGUCC
Data type | Count |
13C chemical shifts | 187 |
15N chemical shifts | 50 |
1H chemical shifts | 285 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | primer_loop | 1 |
Entity 1, primer_loop 37 residues - Formula weight is not available
1 | G | G | A | C | G | A | U | C | U | U | ||||
2 | U | A | C | G | U | C | C | G | C | U | ||||
3 | U | C | G | G | C | G | G | A | C | U | ||||
4 | G | U | C | G | U | C | C |
unlabeled(H2O): EDHBVwt 0.19 ± 0.01 mM; sodium phosphate 10 ± 0.5 mM; EDTA 0.1 ± 0.05 mM
labeled(H2O): EDHBVwt, [U-99% 13C; U-99% 15N], 1.00 ± 0.05 mM; EDTA 0.1 ± 0.05 mM; sodium phosphate 10 ± 0.5 mM; DSS 1.5 ± 0.05 mM
unlabeled(D2O): EDHBVwt 0.19 ± 0.01 mM; sodium phosphate 10 ± 0.5 mM; EDTA 0.1 ± 0.05 mM
5C_labelled: ionic strength: 23.0 mM; pH: 6.5; pressure: 1 atm; temperature: 278 K
15C_labelled: ionic strength: 23.0 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K
25C_labelled: ionic strength: 23.0 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
5C_unlabelled: ionic strength: 12.0 mM; pH: 6.5; pressure: 1 atm; temperature: 278 K
15C_unlabelled: ionic strength: 12.0 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K
25C_unlabelled: ionic strength: 12.0 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | unlabeled(H2O) | isotropic | 15C_unlabelled |
2D HCCH-COSY | labeled(H2O) | isotropic | 25C_labelled |
2D H1/3(N1/3)C2 | labeled(H2O) | isotropic | 25C_labelled |
2D 1H-15N HSQC | labeled(H2O) | isotropic | 15C_labelled |
2D 1H-1H NOESY | unlabeled(D2O) | isotropic | 25C_unlabelled |
2D DQF-COSY | unlabeled(D2O) | isotropic | 25C_unlabelled |
2D 1H-15N HSQC | labeled(H2O) | isotropic | 5C_labelled |
2D 1H-13C HSQC | labeled(H2O) | isotropic | 15C_labelled |
H5(C5)C4 | labeled(H2O) | isotropic | 15C_labelled |
3D HCCH-TOCSY | labeled(H2O) | isotropic | 25C_labelled |
3D-HCN | labeled(H2O) | isotropic | 25C_labelled |
H1/3(N1/3)C4/6 | labeled(H2O) | isotropic | 25C_labelled |
2D 1H-15N HSQC | labeled(H2O) | isotropic | 15C_labelled |
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY, Goddard - chemical shift assignment, collection, peak picking