Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19448
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wilson, Tom; Costa, Paulo; Felix, Vitor; Williamson, Mike; Thomas, Jim. "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence." J. Med. Chem. 56, 8674-8683 (2013).
PubMed: 24088028
Assembly members:
human_telomere_quadruplex, polymer, 22 residues, Formula weight is not available
entity_2FJ, non-polymer, 1211.268 Da.
entity_NA, non-polymer, 22.990 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
human_telomere_quadruplex: AGGGTTAGGGTTAGGGTTAG
GG
Data type | Count |
1H chemical shifts | 196 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | human telomere quadruplex | 1 |
2 | LL-(Ru[bipy]2)tppz4+, ligand | 2 |
3 | Na+, 1 | 3 |
4 | Na+, 2 | 3 |
Entity 1, human telomere quadruplex 22 residues - Formula weight is not available
1 | DA | DG | DG | DG | DT | DT | DA | DG | DG | DG | ||||
2 | DT | DT | DA | DG | DG | DG | DT | DT | DA | DG | ||||
3 | DG | DG |
Entity 2, LL-(Ru[bipy]2)tppz4+, ligand - C64 H44 N14 Ru2 - 1211.268 Da.
1 | 2FJ |
Entity 3, Na+, 1 - Na - 22.990 Da.
1 | NA |
sample_1: human telomere quadruplex 300 uM; LL-(Ru[bipy]2)tppz4+ 300 uM; sodium chloride 50 mM
sample_conditions_1: ionic strength: 50 mM; pH: 7; pressure: 1 atm; temperature: 298 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-31P HSQC | sample_1 | isotropic | sample_conditions_1 |
X-PLOR NIH v2.14, Schwieters, Kuszewski, Tjandra and Clore - structure solution