Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6094
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: D'Souza, Victoria; Dey, Anwesha; Habib, Dina; Summers, Michael. "NMR structure of the 101 nucleotide core encapsidation signal of the moloney
murine leukemia virus" J. Mol. Biol. 337, 427-442 (2004).
PubMed: 15003457
Assembly members:
single chain of RNA, polymer, 101 residues, Formula weight is not available
Natural source: Common Name: Moloney Murine Leukemia Virus Taxonomy ID: 11786 Superkingdom: Viruses Kingdom: not available Genus/species: Gammaretrovirus murine leukemia virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
single chain of RNA: GGCGGUACUAGUUGAGAAAC
UAGCUCUGUAUCUGGUGGAC
CCGUGGUGGAACUGUGAAGU
UCGGAACACCCGGCCGCAAC
CCUGGGAGAGGUCCCAGGGU
U
| Data type | Count |
| 13C chemical shifts | 578 |
| 15N chemical shifts | 35 |
| 1H chemical shifts | 683 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | psi site monomer | 1 |
Entity 1, psi site monomer 101 residues - Formula weight is not available
| 1 | G | G | C | G | G | U | A | C | U | A | ||||
| 2 | G | U | U | G | A | G | A | A | A | C | ||||
| 3 | U | A | G | C | U | C | U | G | U | A | ||||
| 4 | U | C | U | G | G | U | G | G | A | C | ||||
| 5 | C | C | G | U | G | G | U | G | G | A | ||||
| 6 | A | C | U | G | U | G | A | A | G | U | ||||
| 7 | U | C | G | G | A | A | C | A | C | C | ||||
| 8 | C | G | G | C | C | G | C | A | A | C | ||||
| 9 | C | C | U | G | G | G | A | G | A | G | ||||
| 10 | G | U | C | C | C | A | G | G | G | U | ||||
| 11 | U |
sample_1: single chain of RNA, [13C; 15N]-Ade, 1.2
sample_2: single chain of RNA, [13C; 15N]-Gua, 1.2
sample_3: single chain of RNA, [13C; 15N]-Cyt, 1.2
sample_4: single chain of RNA, [13C; 15N]-Ura, 1.2
sample_5: single chain of RNA, [15N]-Gua-Ura, 1.2
sample_6: single chain of RNA, [2D]-Ade-Ura-Cyt, 1.2
sample_7: single chain of RNA, [2D]-Ade-Gua-Ura, 1.2
sample_8: single chain of RNA, [2D]-Ade-Gua-Cyt, 1.2
sample_9: single chain of RNA, [2D]-Gua-Cyt-Ura, 1.2
cond-1: pH: 7.0; temperature: 308 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | cond-1 |
| 2D ROESY | not available | not available | cond-1 |
| 2D HMQC | not available | not available | cond-1 |
| 3D HMQC-NOESY | not available | not available | cond-1 |
| 4d-HMQC NOESY HMQC | not available | not available | cond-1 |
| 2D 1H-15N HSQC | not available | not available | cond-1 |
| 3D HSQC-NOESY | not available | not available | cond-1 |
No software information available