Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5834
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Staple, David; Butcher, Samuel. "Solution Structure of the HIV-1 Frameshift Inducing Stem-loop RNA" Nucleic Acids Res. 31, 4326-4331 (2003).
PubMed: 12888491
Assembly members:
HIV-1 frameshift inducing stem-loop RNA, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: HIV Taxonomy ID: 12721 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
HIV-1 frameshift inducing stem-loop RNA: GGCCUUCCCACAAGGGAAGG
CC
Data type | Count |
13C chemical shifts | 59 |
15N chemical shifts | 31 |
1H chemical shifts | 155 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | HIV-1 frameshift inducing stem-loop RNA | 1 |
Entity 1, HIV-1 frameshift inducing stem-loop RNA 22 residues - Formula weight is not available
1 | G | G | C | C | U | U | C | C | C | A | ||||
2 | C | A | A | G | G | G | A | A | G | G | ||||
3 | C | C |
Sample_1: HIV-1 frameshift inducing stem-loop RNA 1.0 mM
condition_1: pH: 6.8; temperature: 303 K
condition_2: pH: 6.8; temperature: 283 K
condition_3: pH: 6.8; temperature: 298 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
1H-1H NOESY | not available | not available | not available |
1H-1H TOCSY | not available | not available | not available |
1H-13C HSQC | not available | not available | not available |
HCCH-TOCSY | not available | not available | not available |
HCCH-COSY | not available | not available | not available |
HNN-COSY | not available | not available | not available |
1H-13C-1H NOESY HMQC | not available | not available | not available |
No software information available