BMRB Entry 50349

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50349

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Title:
Assignment of base 15N and 1H chemical shifts for <5_SL1>
Deposition date:
2020-06-23
Original release date:
2020-07-10
Authors:
Schwalbe, Harald; Richter, Christian
Citation:

Citation: Wacker, Anna; Weigand, Julia; Akabayov, Sabine; Altincekic, Nadide; Kaur Bains, Jasleen; Banijamali, Elnaz; Binas, Oliver; Castillo-Martinez, Jesus; Cetiner, Erhan; Ceylan, Betul; Chiu, Liang-Yuan; Davila-Calderon, Jesse; De Jesus, Vanessa; Dhamotharan, Karthikeyan; Duchardt-Ferner, Elke; Ferner, Jan; Frydman, Lucio; Furtig, Boris; Gallego, Jose; Grun, J. Tassilo; Hacker, Carolin; Haddad, Christina; Hahnke, Martin; Hengesbach, Martin; Hiller, Fabian; Hohmann, Katharina; Hymon, Daniel; Jonker, Henry; Keller, Heiko; Knezic, Bozana; Landgraf, Tom; Lohr, Frank; Luo, Luke; Mertinkus, Klara; Muhs, Christina; Novakovic, Mihajlo; Oxenfarth, Andreas; Palomino-Schatzlein, Martina; Petzold, Katja; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Riad, Magdalena; Richter, Christian; Saxena, Krishna; Schamber, Tatjana; Scherf, Tali; Schlagnitweit, Judith; Schlundt, Andreas; Schnieders, Robbin; Schwalbe, Harald; Simba-Lahuasi, Alvaro; Sreeramulu, Sridhar; Stirnal, Elke; Sudakov, Alexey; Tants, Jan-Niklas; Tolbert, Blanton; Vogele, Jenny; Weiss, Lena; Wirmer-Bartoschek, Julia; Wirtz Martin, Maria; Wohnert, Jens; Zetzsche, Heidi. "Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy"  Nucleic Acids Res. 48, 12415-12435 (2020).
PubMed: 33167030

Assembly members:

Assembly members:
entity_1, polymer, 29 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: SARS-CoV-2   Taxonomy ID: 2697049   Superkingdom: Viruses   Kingdom: not available   Genus/species: Betacoronavirus HCoV-SARS

Experimental source:

Experimental source:   Production method: transcription   Host organism: in vitro

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGGUUUAUACCUUCCCAGGU AACAAACCC

Data sets:
Data typeCount
13C chemical shifts245
15N chemical shifts106
1H chemical shifts258
heteronuclear NOE values37
residual dipolar couplings18

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
15_SL11

Entities:

Entity 1, 5_SL1 29 residues - Formula weight is not available

1   GGGUUUAUAC
2   CUUCCCAGGU
3   AACAAACCC