BMRB Entry 31077
Click here to enlarge.
PDB ID: 8scf
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31077
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Warden, M.; DeRose, E.; Tamayo, J.; Mueller, G.; Gavis, E.; Hall, T.. "The translational repressor Glorund uses interchangeable RNA recognition domains to recognize Drosophila nanos" Nucleic Acids Res. 51, 8836-8849 (2023).
PubMed: 37427795
Assembly members:
entity_1, polymer, 30 residues, 9568.722 Da.
Natural source: Common Name: fruit fly Taxonomy ID: 7227 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Drosophila melanogaster
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GCGUUUAUAUAACAUGAAAU
AUAUAUACGC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 83 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 171 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 30 residues - 9568.722 Da.
| 1 | G | C | G | U | U | U | A | U | A | U | |
| 2 | A | A | C | A | U | G | A | A | A | U | |
| 3 | A | U | A | U | A | U | A | C | G | C |