Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31077
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Warden, M.; DeRose, E.; Tamayo, J.; Mueller, G.; Gavis, E.; Hall, T.. "The translational repressor Glorund uses interchangeable RNA recognition domains to recognize Drosophila nanos" Nucleic Acids Res. 51, 8836-8849 (2023).
PubMed: 37427795
Assembly members:
entity_1, polymer, 30 residues, 9568.722 Da.
Natural source: Common Name: fruit fly Taxonomy ID: 7227 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Drosophila melanogaster
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GCGUUUAUAUAACAUGAAAU
AUAUAUACGC
Data type | Count |
13C chemical shifts | 83 |
15N chemical shifts | 11 |
1H chemical shifts | 171 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 30 residues - 9568.722 Da.
1 | G | C | G | U | U | U | A | U | A | U | |
2 | A | A | C | A | U | G | A | A | A | U | |
3 | A | U | A | U | A | U | A | C | G | C |
sample_1: TCEIII, [U-13C; U-15N], 0.7 mM; sodium phosphate 10 mM
sample_2: TCEIII, [U-13C; U-15N], 0.7 mM; sodium phosphate 10 mM
sample_3: TCEIII, [U-13C; U-15N], 0.7 mM; sodium phosphate 10 mM; Pf1 phage 13 mg/mL
sample_conditions_1: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K
sample_conditions_2: ionic strength: 10 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_2 |
2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_2 |
3D 1H-13C NOESY | sample_2 | isotropic | sample_conditions_2 |
1H, 15N ARTSY | sample_3 | anisotropic | sample_conditions_1 |
NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRViewJ, Johnson - chemical shift assignment, data analysis, peak picking
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation