Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50989
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Yi, Jie; Wan, Liqi; Liu, Yuan; Lam, Sik Lok; Chan, Ho Yin Edwin; Han, Da; Guo, Pei. "NMR solution structures of d(GGCCTG) n repeats associated with spinocerebellar ataxia type 36" Int. J. Biol. Macromol. 201, 607-615 (2022).
PubMed: 35077744
Assembly members:
entity_1, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCCTGGGCCTGGGCCTGGG
CCTG
| Data type | Count |
| 1H chemical shifts | 158 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | GGCCTG4 | 1 |
Entity 1, GGCCTG4 24 residues - Formula weight is not available
| 1 | DG | DG | DC | DC | DT | DG | DG | DG | DC | DC | ||||
| 2 | DT | DG | DG | DG | DC | DC | DT | DG | DG | DG | ||||
| 3 | DC | DC | DT | DG |
sample_1: GGCCTG4 0.3 mM
sample_conditions_1: ionic strength: 1 mM; pH: 7; pressure: 1 atm; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN - chemical shift assignment