Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52424
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Hernandez-Marin, Maria; Cantero-Camacho, Angel; Mena, Ignacio; Lopez-Nunez, Sergio; Garcia-Sastre, Adolfo; Gallego, Jose. "Sarbecovirus programmed ribosome frameshift RNA element folding studied by NMR spectroscopy and comparative analyses
" Nucleic Acids Res 52, 11960-11972 (2024).
PubMed: 39149904
Assembly members:
entity_1, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: in vitro transcription Host organism: Not applicable
Entity Sequences (FASTA):
entity_1: GGUGCUUCAGUCAGCUGAUG
CACC
| Data type | Count |
| 15N chemical shifts | 22 |
| 1H chemical shifts | 24 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Attenuator hairpin of SARS-CoV-2 PRF | 1 |
Entity 1, Attenuator hairpin of SARS-CoV-2 PRF 24 residues - Formula weight is not available
The sequences experimentally analyzed in this study correspond to SARS-CoV-2 isolate Wuhan-Hu-1 (NCBI NC_045512). To obtain genomic numbering add 13,419 to the author's sequence numbers.
| 1 | G | G | U | G | C | U | U | C | A | G | ||||
| 2 | U | C | A | G | C | U | G | A | U | G | ||||
| 3 | C | A | C | C |
sample_1: Attenuator hairpin of SARS-CoV-2 PRF, [U-99% 13C; U-99% 15N], 635 uM; potassium phosphate 25 mM; potassium chloride 50 mM
sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HNN-COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC NH2 only | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN v3.6.1 - collection, data analysis
NMRFARM-Sparky v1.414 - data analysis