Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6239
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Flinders, Jeremy; Dieckmann, Thorsten. "The Solution Structure of the VS Ribozyme Active Site Loop Reveals a Dynamic
'Hotspot'" J. Mol. Biol. 341, 935-949 (2004).
PubMed: 15328609
Assembly members:
VSVI RNA, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Neurospora crassa Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Neurospora crassa
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
VSVI RNA: GGUGACGCCGUAAGGCGCAG
CC
| Data type | Count |
| 13C chemical shifts | 139 |
| 15N chemical shifts | 1 |
| 1H chemical shifts | 183 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | VSVI RNA | 1 |
Entity 1, VSVI RNA 22 residues - Formula weight is not available
| 1 | G | G | U | G | A | C | G | C | C | G | ||||
| 2 | U | A | A | G | G | C | G | C | A | G | ||||
| 3 | C | C |
sample_1: VSVI RNA 1.5 mM
sample_2: VSVI RNA, [U-95% 13C; U-95% 15N], 1.2 mM
sample_3: VSVI RNA, [U-95% 15N], 1.5 mM
Ex-cond_1: pH: 6.0; temperature: 293 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| not available | not available | not available | Ex-cond_1 |
XWIN-NMR v3.5, Bruker - Acquisition, Processing
SPARKY v3.106, UCSF - Analysis (Peak Picking)