BMRB Entry 5919
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5919
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vallurupalli, Pramodh; Moore, Peter. "The solution structure of the loop E region of the 5S rRNA from spinach
chloroplasts" J. Mol. Biol. 325, 843-856 (2003).
PubMed: 12527295
Assembly members:
Loop E of 5S rRNA from spinach chloroplasts, polymer, 42 residues, 14468 Da.
Natural source: Common Name: Spinach Taxonomy ID: 3562 Superkingdom: Eukaryota Kingdom: Viridiplantae Genus/species: Spinacia oleracea
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Loop E of 5S rRNA from spinach chloroplasts: GGGUGACGAUACUGUAGGCG
AGAGCCUGCGGAAAAAUAGC
CC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 110 |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 253 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Loop E of 5S rRNA from spinach chloroplasts | 1 |
Entities:
Entity 1, Loop E of 5S rRNA from spinach chloroplasts 42 residues - 14468 Da.
| 1 | G | G | G | U | G | A | C | G | A | U | ||||
| 2 | A | C | U | G | U | A | G | G | C | G | ||||
| 3 | A | G | A | G | C | C | U | G | C | G | ||||
| 4 | G | A | A | A | A | A | U | A | G | C | ||||
| 5 | C | C |
Samples:
Sample_1: Loop E of 5S rRNA from spinach chloroplasts 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 10%; H2O 90%
Sample_2: Loop E of 5S rRNA from spinach chloroplasts 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 100%
Sample_3: Loop E of 5S rRNA from spinach chloroplasts, [U->90% 13C; U->90% 15N], 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 10%; H2O 90%
Sample_4: Loop E of 5S rRNA from spinach chloroplasts, [U->90% 13C; U->90% 15N], 1.5 mM; NaCl 50 mM; Cacodylate 2.5 mM; EDTA 0.1 mM; D2O 100%
Cond_1: pH: 6.5; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H-15NHSQC | not available | not available | not available |
| 1H-13CHSQC | not available | not available | not available |
| 1H-13CNOESY-HMQC | not available | not available | not available |
| HCcH COSY | not available | not available | not available |
| Relay HCcH COSY | not available | not available | not available |
| Double Relay HCcH COSY | not available | not available | not available |
| IPAP HSQC | not available | not available | not available |
| IPAP HCcH COSY | not available | not available | not available |
| IPAP Relay HCcH COSY | not available | not available | not available |
| NOESY | not available | not available | not available |
| DQF-COSY | not available | not available | not available |
Software:
FELIX -
SPARKY -
NMR spectrometers:
- Varian INOVA 500 MHz
- Varian UnityPlus 500 MHz
- Varian INOVA 500 MHz