Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50095
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Catala, Marjorie; Gato, Alexandre; Tisne, Carine; Barraud, Pierre. "1H, 15N chemical shift assignments of the imino groups of yeast tRNA Phe: influence of the post-transcriptional modifications" Biomol. NMR Assignments 14, 169-174 (2020).
PubMed: 32239363
Assembly members:
unmodified yeast tRNAPhe, polymer, 76 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
unmodified yeast tRNAPhe: GCGGAUUUAGCUCAGUUGGG
AGAGCGCCAGACUGAAGAUC
UGGAGGUCCUGUGUUCGAUC
CACAGAAUUCGCACCA
| Data type | Count |
| 15N chemical shifts | 27 |
| 1H chemical shifts | 27 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | tRNAPhe | 1 |
Entity 1, tRNAPhe 76 residues - Formula weight is not available
| 1 | G | C | G | G | A | U | U | U | A | G | ||||
| 2 | C | U | C | A | G | U | U | G | G | G | ||||
| 3 | A | G | A | G | C | G | C | C | A | G | ||||
| 4 | A | C | U | G | A | A | G | A | U | C | ||||
| 5 | U | G | G | A | G | G | U | C | C | U | ||||
| 6 | G | U | G | U | U | C | G | A | U | C | ||||
| 7 | C | A | C | A | G | A | A | U | U | C | ||||
| 8 | G | C | A | C | C | A |
sample_1: entity_1 1.8-2.0 mM; sodium phosphate 10 mM; magnesium chloride 10 mM
sample_2: entity_1, [U-15N]-Gua, [U-15N]-Ura, 1.5-1.8 mM; sodium phosphate 10 mM; magnesium chloride 10 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 311 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N BEST-TROSY | sample_2 | isotropic | sample_conditions_1 |
| 3D 1H-15N NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
TOPSPIN v3.5, Bruker Biospin - collection, processing
SPARKY, Goddard - chemical shift assignment, data analysis
| tRNADB | tdbR00000083 |