Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52477
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Yared, Marcel-Joseph; Chagneau, Carine; Barraud, Pierre. "Imino chemical shift assignments of tRNAAsp, tRNAVal and tRNAPhe from Escherichia coli" Biomol. NMR Assignments 18, 323-331 (2024).
PubMed: 39365419
Assembly members:
entity_1, polymer, 77 residues, Formula weight is not available
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGAGCGGUAGUUCAGUCGGU
UAGAAUACCUGCCUGUCACG
CAGGGGGUCGCGGGUUCGAG
UCCCGUCCGUUCCGCCA
| Data type | Count |
| 15N chemical shifts | 29 |
| 1H chemical shifts | 29 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unmodified tRNAAsp | 1 |
Entity 1, unmodified tRNAAsp 77 residues - Formula weight is not available
| 1 | G | G | A | G | C | G | G | U | A | G | ||||
| 2 | U | U | C | A | G | U | C | G | G | U | ||||
| 3 | U | A | G | A | A | U | A | C | C | U | ||||
| 4 | G | C | C | U | G | U | C | A | C | G | ||||
| 5 | C | A | G | G | G | G | G | U | C | G | ||||
| 6 | C | G | G | G | U | U | C | G | A | G | ||||
| 7 | U | C | C | C | G | U | C | C | G | U | ||||
| 8 | U | C | C | G | C | C | A |
sample_1: unmodified E. coli tRNAAsp 0.55 mM; sodium phosphate 10 mM; magnesium chloride 10 mM; D2O 5%
sample_2: unmodified E. coli tRNAAsp, [U-15N]-Ura/Gua, 0.27 mM; sodium phosphate 10 mM; magnesium chloride 10 mM; D2O 5%
sample_conditions_1: ionic strength: 30 mM; pH: 6.0; pressure: 1 atm; temperature: 311 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY | sample_2 | isotropic | sample_conditions_1 |
TOPSPIN - collection, processing
NMRFAM-SPARKY - chemical shift assignment