Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52477
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Yared, Marcel-Joseph; Chagneau, Carine; Barraud, Pierre. "Imino chemical shift assignments of tRNAAsp, tRNAVal and tRNAPhe from Escherichia coli" Biomol. NMR Assignments 18, 323-331 (2024).
PubMed: 39365419
Assembly members:
entity_1, polymer, 77 residues, Formula weight is not available
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGAGCGGUAGUUCAGUCGGU
UAGAAUACCUGCCUGUCACG
CAGGGGGUCGCGGGUUCGAG
UCCCGUCCGUUCCGCCA
Data type | Count |
15N chemical shifts | 29 |
1H chemical shifts | 29 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unmodified tRNAAsp | 1 |
Entity 1, unmodified tRNAAsp 77 residues - Formula weight is not available
1 | G | G | A | G | C | G | G | U | A | G | ||||
2 | U | U | C | A | G | U | C | G | G | U | ||||
3 | U | A | G | A | A | U | A | C | C | U | ||||
4 | G | C | C | U | G | U | C | A | C | G | ||||
5 | C | A | G | G | G | G | G | U | C | G | ||||
6 | C | G | G | G | U | U | C | G | A | G | ||||
7 | U | C | C | C | G | U | C | C | G | U | ||||
8 | U | C | C | G | C | C | A |